DDA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51937-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DDA1 Reagents
CRO Services
Product recommended

All DDA1 Reagents
DDA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
309 bp
Description
Full length Clone DNA of Mouse DET1 and DDB1 associated 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1500034J01Rik cDNA ORF Clone, Mouse;1700095J19Rik cDNA ORF Clone, Mouse;R74921 cDNA ORF Clone, Mouse
DDA1 Background Information
Full Name
DET1 and DDB1 associated 1

DDA1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
DDA1 cDNA ORF Clone in Cloning Vector, Canine DG70249-U
DDA1 cDNA ORF Clone, Canine, untagged DG70249-UT
DDA1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70249-ACGLN
DDA1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70249-ACG
DDA1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70249-ANG
DDA1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70249-ACR
DDA1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70249-ANR
DDA1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70249-CF
DDA1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70249-NF
DDA1 cDNA ORF Clone, Canine, C-His tag DG70249-CH
DDA1 cDNA ORF Clone, Canine, N-His tag DG70249-NH
DDA1 cDNA ORF Clone, Canine, C-HA tag DG70249-CY
DDA1 cDNA ORF Clone, Canine, N-HA tag DG70249-NY
DDA1 cDNA ORF Clone, Canine, C-Myc tag DG70249-CM
DDA1 cDNA ORF Clone, Canine, N-Myc tag DG70249-NM

DDA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DDA1 cDNA ORF Clone in Cloning Vector, Rat RG81587-G

DDA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDA1 cDNA ORF Clone in Cloning Vector, Mouse MG51937-U
DDA1 cDNA ORF Clone, Mouse, untagged MG51937-UT
DDA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51937-ACGLN
DDA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51937-ACG
DDA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51937-ANG
DDA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51937-ACR
DDA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51937-ANR
DDA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51937-CF
DDA1 cDNA ORF Clone, Mouse, C-His tag MG51937-CH
DDA1 cDNA ORF Clone, Mouse, N-His tag MG51937-NH
DDA1 cDNA ORF Clone, Mouse, C-HA tag MG51937-CY
DDA1 cDNA ORF Clone, Mouse, N-HA tag MG51937-NY
DDA1 cDNA ORF Clone, Mouse, C-Myc tag MG51937-CM
DDA1 cDNA ORF Clone, Mouse, N-Myc tag MG51937-NM
DDA1 qPCR Primer Pairs, Mouse MP201810

DDA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDA1 cDNA ORF Clone in Cloning Vector, Human HG16977-U
DDA1 cDNA ORF Clone, Human, untagged HG16977-UT
DDA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16977-ACGLN
DDA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16977-ACG
DDA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16977-ANG
DDA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16977-ACR
DDA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16977-ANR
DDA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16977-CF
DDA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16977-NF
DDA1 cDNA ORF Clone, Human, C-His tag HG16977-CH
DDA1 cDNA ORF Clone, Human, N-His tag HG16977-NH
DDA1 cDNA ORF Clone, Human, C-HA tag HG16977-CY
DDA1 cDNA ORF Clone, Human, N-HA tag HG16977-NY
DDA1 cDNA ORF Clone, Human, C-Myc tag HG16977-CM
DDA1 cDNA ORF Clone, Human, N-Myc tag HG16977-NM
info info
添加购物车成功! 添加购物车失败!