DCTN5 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52239-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCTN5 Reagents
CRO Services
Product recommended

All DCTN5 Reagents
DCTN5 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
549 bp
Description
Full length Clone DNA of Mouse dynactin 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN5 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
4930427E12Rik cDNA ORF Clone, Mouse;b2b315Clo cDNA ORF Clone, Mouse;C78178 cDNA ORF Clone, Mouse
DCTN5 Background Information
Full Name
dynactin 5 (p25)

DCTN5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN5 cDNA ORF Clone in Cloning Vector, Mouse MG52239-U
DCTN5 cDNA ORF Clone, Mouse, untagged MG52239-UT
DCTN5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52239-ACG
DCTN5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52239-ACGLN
DCTN5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52239-ANG
DCTN5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52239-ACR
DCTN5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52239-ANR
DCTN5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52239-CF
DCTN5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52239-NF
DCTN5 cDNA ORF Clone, Mouse, C-His tag MG52239-CH
DCTN5 cDNA ORF Clone, Mouse, N-His tag MG52239-NH
DCTN5 cDNA ORF Clone, Mouse, C-HA tag MG52239-CY
DCTN5 cDNA ORF Clone, Mouse, C-Myc tag MG52239-CM
DCTN5 cDNA ORF Clone, Mouse, N-Myc tag MG52239-NM
DCTN5 qPCR Primer Pairs, Mouse MP202112

DCTN5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN5 cDNA ORF Clone in Cloning Vector, Human HG14169-G
DCTN5 cDNA ORF Clone, Human, untagged HG14169-UT
DCTN5 cDNA ORF Clone, Human, C-GFPSpark® tag HG14169-ACG
DCTN5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14169-ACGLN
DCTN5 cDNA ORF Clone, Human, N-GFPSpark® tag HG14169-ANG
DCTN5 cDNA ORF Clone, Human, C-OFPSpark® tag HG14169-ACR
DCTN5 cDNA ORF Clone, Human, N-OFPSpark® tag HG14169-ANR
DCTN5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14169-CF
DCTN5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14169-NF
DCTN5 cDNA ORF Clone, Human, C-His tag HG14169-CH
DCTN5 cDNA ORF Clone, Human, N-His tag HG14169-NH
DCTN5 cDNA ORF Clone, Human, C-HA tag HG14169-CY
DCTN5 cDNA ORF Clone, Human, N-HA tag HG14169-NY
DCTN5 cDNA ORF Clone, Human, C-Myc tag HG14169-CM
DCTN5 cDNA ORF Clone, Human, N-Myc tag HG14169-NM
DCTN5 qPCR Primer Pairs, Human HP102820
info info
添加购物车成功! 添加购物车失败!