DCAF12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51742-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCAF12 Reagents
CRO Services
Product recommended

All DCAF12 Reagents
DCAF12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Mouse DDB1 and CUL4 associated factor 12 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCAF12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1500001L20Rik cDNA ORF Clone, Mouse;5830424K06Rik cDNA ORF Clone, Mouse;AA420338 cDNA ORF Clone, Mouse;AI851081 cDNA ORF Clone, Mouse;Wdr40a cDNA ORF Clone, Mouse
DCAF12 Background Information
Full Name
DDB1 and CUL4 associated factor 12

DCAF12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCAF12 cDNA ORF Clone in Cloning Vector, Mouse MG51742-G
DCAF12 cDNA ORF Clone, Mouse, untagged MG51742-UT
DCAF12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51742-ACG
DCAF12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51742-ACGLN
DCAF12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51742-ANG
DCAF12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51742-ACR
DCAF12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51742-ANR
DCAF12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51742-NF
DCAF12 cDNA ORF Clone, Mouse, C-His tag MG51742-CH
DCAF12 cDNA ORF Clone, Mouse, N-His tag MG51742-NH
DCAF12 cDNA ORF Clone, Mouse, C-HA tag MG51742-CY
DCAF12 cDNA ORF Clone, Mouse, N-HA tag MG51742-NY
DCAF12 cDNA ORF Clone, Mouse, C-Myc tag MG51742-CM
DCAF12 cDNA ORF Clone, Mouse, N-Myc tag MG51742-NM
DCAF12 qPCR Primer Pairs, Mouse MP201615

DCAF12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCAF12 cDNA ORF Clone in Cloning Vector, Human HG18829-U
DCAF12 cDNA ORF Clone, Human, untagged HG18829-UT
DCAF12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18829-ACGLN
DCAF12 cDNA ORF Clone, Human, C-GFPSpark® tag HG18829-ACG
DCAF12 cDNA ORF Clone, Human, N-GFPSpark® tag HG18829-ANG
DCAF12 cDNA ORF Clone, Human, C-OFPSpark® tag HG18829-ACR
DCAF12 cDNA ORF Clone, Human, N-OFPSpark® tag HG18829-ANR
DCAF12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18829-CF
DCAF12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18829-NF
DCAF12 cDNA ORF Clone, Human, C-His tag HG18829-CH
DCAF12 cDNA ORF Clone, Human, N-His tag HG18829-NH
DCAF12 cDNA ORF Clone, Human, C-HA tag HG18829-CY
DCAF12 cDNA ORF Clone, Human, N-HA tag HG18829-NY
DCAF12 cDNA ORF Clone, Human, C-Myc tag HG18829-CM
DCAF12 cDNA ORF Clone, Human, N-Myc tag HG18829-NM
info info
添加购物车成功! 添加购物车失败!