Cystatin C cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50239-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cystatin C Reagents
CRO Services
Product recommended

All Cystatin C Reagents
Cystatin C cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Mouse cystatin C with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin C cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
CysC cDNA ORF Clone, Mouse
Cystatin C Background Information

Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate. The mature, active form of human cystatin C is a single non-glycosylated polypeptide chain consisting of 120 amino acid residues, with a molecular mass of 13,343-13,359 Da, and containing four characteristic disulfide-paired cysteine residues. Cystatin C is a low-molecular-weight protein which has been proposed as a marker of renal function that could replace creatinine. Indeed, the concentration of Cystatin C is mainly determined by glomerular filtration and is particularly of interest in clinical settings where the relationship between creatinine production and muscle mass impairs the clinical performance of creatinine. Since the last decade, numerous studies have evaluated its potential use in measuring renal function in various populations. More recently, other potential developments for its clinical use have emerged. In almost all the clinical studies, Cystatin C demonstrated a better diagnostic accuracy than serum creatinine in discriminating normal from impaired kidney function, but controversial results have been obtained by comparing this protein with other indices of kidney disease, especially serum creatinine-based equations, such as early atherosclerosis, Alzheimer's dementia, vascular aneurysms, hyperhomocysteinaemia and other neurodegenerative diseases. Cystatin C could be a useful clinical tool to identify HIV-infected persons. In addition, its expression is up-regulated in malignance of certain tumor progression.

Full Name
cystatin C
References
  • Mares J, et al. (2003) Use of cystatin C determination in clinical diagnostics. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147(2): 177-80.
  • Mussap M, et al. (2004) Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci. 41(5-6): 467-550.
  • Sronie-Vivien S, et al. (2008) Cystatin C: current position and future prospects. Clin Chem Lab Med. 46(12): 1664-86.
  • Taglieri N, et al. (2009) Cystatin C and cardiovascular risk. Clin Chem. 55(11): 1932-43.
  • Cystatin C cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cystatin C cDNA ORF Clone in Cloning Vector, Rat RG80040-M
    Cystatin C cDNA ORF Clone, Rat, untagged RG80040-UT
    Cystatin C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80040-ACGLN
    Cystatin C cDNA ORF Clone, Rat, C-GFPSpark® tag RG80040-ACG
    Cystatin C cDNA ORF Clone, Rat, C-OFPSpark® tag RG80040-ACR
    Cystatin C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80040-CF
    Cystatin C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80040-NF
    Cystatin C cDNA ORF Clone, Rat, C-His tag RG80040-CH
    Cystatin C cDNA ORF Clone, Rat, N-His tag RG80040-NH
    Cystatin C cDNA ORF Clone, Rat, C-HA tag RG80040-CY
    Cystatin C cDNA ORF Clone, Rat, N-HA tag RG80040-NY
    Cystatin C cDNA ORF Clone, Rat, C-Myc tag RG80040-CM
    Cystatin C cDNA ORF Clone, Rat, N-Myc tag RG80040-NM
    Cystatin C qPCR Primer Pairs, Rat RP300039

    Cystatin C cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cystatin C cDNA ORF Clone in Cloning Vector, Mouse MG50239-M
    Cystatin C cDNA ORF Clone, Mouse, untagged MG50239-UT
    Cystatin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50239-ACGLN
    Cystatin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50239-ACG
    Cystatin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50239-ACR
    Cystatin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50239-CF
    Cystatin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50239-NF
    Cystatin C cDNA ORF Clone, Mouse, C-His tag MG50239-CH
    Cystatin C cDNA ORF Clone, Mouse, N-His tag MG50239-NH
    Cystatin C cDNA ORF Clone, Mouse, C-HA tag MG50239-CY
    Cystatin C cDNA ORF Clone, Mouse, N-HA tag MG50239-NY
    Cystatin C cDNA ORF Clone, Mouse, C-Myc tag MG50239-CM
    Cystatin C qPCR Primer Pairs, Mouse MP200265

    Cystatin C cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cystatin C cDNA ORF Clone in Cloning Vector, Human HG10439-G
    Cystatin C cDNA ORF Clone, Human, untagged HG10439-UT
    Cystatin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10439-ACGLN
    Cystatin C cDNA ORF Clone, Human, C-GFPSpark® tag HG10439-ACG
    Cystatin C cDNA ORF Clone, Human, C-OFPSpark® tag HG10439-ACR
    Cystatin C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10439-CF
    Cystatin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10439-NF
    Cystatin C cDNA ORF Clone, Human, C-His tag HG10439-CH
    Cystatin C cDNA ORF Clone, Human, N-His tag HG10439-NH
    Cystatin C cDNA ORF Clone, Human, C-HA tag HG10439-CY
    Cystatin C cDNA ORF Clone, Human, N-HA tag HG10439-NY
    Cystatin C cDNA ORF Clone, Human, C-Myc tag HG10439-CM
    Cystatin C cDNA ORF Clone, Human, N-Myc tag HG10439-NM
    Cystatin C qPCR Primer Pairs, Human HP100468
    info info
    添加购物车成功! 添加购物车失败!