CYB561 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51884-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CYB561 Reagents
CRO Services
Product recommended

All CYB561 Reagents
CYB561 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Mouse cytochrome b-561 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYB561 Background Information
Full Name
cytochrome b561

CYB561 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CYB561 cDNA ORF Clone in Cloning Vector, Mouse MG51884-G
CYB561 cDNA ORF Clone, Mouse, untagged MG51884-UT
CYB561 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51884-ACG
CYB561 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51884-ACGLN
CYB561 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51884-ANG
CYB561 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51884-ACR
CYB561 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51884-ANR
CYB561 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51884-CF
CYB561 cDNA ORF Clone, Mouse, C-His tag MG51884-CH
CYB561 cDNA ORF Clone, Mouse, N-His tag MG51884-NH
CYB561 cDNA ORF Clone, Mouse, C-HA tag MG51884-CY
CYB561 cDNA ORF Clone, Mouse, N-HA tag MG51884-NY
CYB561 cDNA ORF Clone, Mouse, C-Myc tag MG51884-CM
CYB561 cDNA ORF Clone, Mouse, N-Myc tag MG51884-NM
CYB561 qPCR Primer Pairs, Mouse MP201757

CYB561 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CYB561 cDNA ORF Clone in Cloning Vector, Human HG21061-U
CYB561 cDNA ORF Clone, Human, untagged HG21061-UT
CYB561 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21061-ACGLN
CYB561 cDNA ORF Clone, Human, C-GFPSpark® tag HG21061-ACG
CYB561 cDNA ORF Clone, Human, N-GFPSpark® tag HG21061-ANG
CYB561 cDNA ORF Clone, Human, C-OFPSpark® tag HG21061-ACR
CYB561 cDNA ORF Clone, Human, N-OFPSpark® tag HG21061-ANR
CYB561 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21061-CF
CYB561 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21061-NF
CYB561 cDNA ORF Clone, Human, C-His tag HG21061-CH
CYB561 cDNA ORF Clone, Human, N-His tag HG21061-NH
CYB561 cDNA ORF Clone, Human, C-HA tag HG21061-CY
CYB561 cDNA ORF Clone, Human, N-HA tag HG21061-NY
CYB561 cDNA ORF Clone, Human, C-Myc tag HG21061-CM
CYB561 cDNA ORF Clone, Human, N-Myc tag HG21061-NM
info info
添加购物车成功! 添加购物车失败!