CXCR5 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50843-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CXCR5 Reagents
CRO Services
Product recommended

All CXCR5 Reagents
CXCR5 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1059C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) receptor 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
HindIII + XbaI (6kb + 1.22kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CXCR5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR5 cDNA ORF Clone, Mouse, N-Myc tag Validated Images
Human HER2/ERBB2 Gene Plasmid Map 5632
CXCR5 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Blr1 cDNA ORF Clone, Mouse;CXC-R5 cDNA ORF Clone, Mouse;CXCR-5 cDNA ORF Clone, Mouse;Gpcr6 cDNA ORF Clone, Mouse;MDR15 cDNA ORF Clone, Mouse
CXCR5 Background Information
Full Name
chemokine (C-X-C motif) receptor 5

CXCR5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CXCR5 cDNA ORF Clone in Cloning Vector, Rhesus CG90240-G
CXCR5 cDNA ORF Clone, Rhesus, untagged CG90240-UT
CXCR5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90240-ACG
CXCR5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90240-ACGLN
CXCR5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90240-ACR
CXCR5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90240-CF
CXCR5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90240-NF
CXCR5 cDNA ORF Clone, Rhesus, C-His tag CG90240-CH
CXCR5 cDNA ORF Clone, Rhesus, N-His tag CG90240-NH
CXCR5 cDNA ORF Clone, Rhesus, C-HA tag CG90240-CY
CXCR5 cDNA ORF Clone, Rhesus, N-HA tag CG90240-NY
CXCR5 cDNA ORF Clone, Rhesus, C-Myc tag CG90240-CM
CXCR5 cDNA ORF Clone, Rhesus, N-Myc tag CG90240-NM

CXCR5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCR5 cDNA ORF Clone in Cloning Vector, Mouse MG50843-G
CXCR5 cDNA ORF Clone, Mouse, untagged MG50843-UT
CXCR5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50843-ACG
CXCR5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50843-ACGLN
CXCR5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50843-ACR
CXCR5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50843-CF
CXCR5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50843-NF
CXCR5 cDNA ORF Clone, Mouse, C-His tag MG50843-CH
CXCR5 cDNA ORF Clone, Mouse, N-His tag MG50843-NH
CXCR5 cDNA ORF Clone, Mouse, C-HA tag MG50843-CY
CXCR5 cDNA ORF Clone, Mouse, N-HA tag MG50843-NY
CXCR5 cDNA ORF Clone, Mouse, C-Myc tag MG50843-CM
CXCR5 qPCR Primer Pairs, Mouse MP200814
info info
添加购物车成功! 添加购物车失败!