CXCL7 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50145-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CXCL7 Reagents
CRO Services
Product recommended

All CXCL7 Reagents
CXCL7 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
342 bp
Description
Full length Clone DNA of Mouse pro-platelet basic protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL7 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2400003M24Rik cDNA ORF Clone, Mouse;AI854500 cDNA ORF Clone, Mouse;b-TG1 cDNA ORF Clone, Mouse;beta-TG cDNA ORF Clone, Mouse;CTAP3 cDNA ORF Clone, Mouse;CTAPIII cDNA ORF Clone, Mouse;Cxcl7 cDNA ORF Clone, Mouse;LA-PF4 cDNA ORF Clone, Mouse;LDGF cDNA ORF Clone, Mouse;MDGF cDNA ORF Clone, Mouse;NAP-2 cDNA ORF Clone, Mouse;NAP-2-L1 cDNA ORF Clone, Mouse;Scyb7 cDNA ORF Clone, Mouse;TGB cDNA ORF Clone, Mouse;TGB1 cDNA ORF Clone, Mouse;THBGB1 cDNA ORF Clone, Mouse
CXCL7 Background Information

Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
References
  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.
  • CXCL7 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CXCL7 cDNA ORF Clone in Cloning Vector, Rhesus CG90132-G
    CXCL7 cDNA ORF Clone, Rhesus, untagged CG90132-UT
    CXCL7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90132-ACGLN
    CXCL7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90132-ACG
    CXCL7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90132-ACR
    CXCL7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90132-CF
    CXCL7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90132-NF
    CXCL7 cDNA ORF Clone, Rhesus, C-His tag CG90132-CH
    CXCL7 cDNA ORF Clone, Rhesus, N-His tag CG90132-NH
    CXCL7 cDNA ORF Clone, Rhesus, C-HA tag CG90132-CY
    CXCL7 cDNA ORF Clone, Rhesus, N-HA tag CG90132-NY
    CXCL7 cDNA ORF Clone, Rhesus, C-Myc tag CG90132-CM
    CXCL7 cDNA ORF Clone, Rhesus, N-Myc tag CG90132-NM

    CXCL7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CXCL7 cDNA ORF Clone in Cloning Vector, Rat RG80066-M
    CXCL7 cDNA ORF Clone, Rat, untagged RG80066-UT
    CXCL7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80066-ACG
    CXCL7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80066-ACGLN
    CXCL7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80066-ACR
    CXCL7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80066-CF
    CXCL7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80066-NF
    CXCL7 cDNA ORF Clone, Rat, C-His tag RG80066-CH
    CXCL7 cDNA ORF Clone, Rat, N-His tag RG80066-NH
    CXCL7 cDNA ORF Clone, Rat, C-HA tag RG80066-CY
    CXCL7 cDNA ORF Clone, Rat, N-HA tag RG80066-NY
    CXCL7 cDNA ORF Clone, Rat, C-Myc tag RG80066-CM
    CXCL7 cDNA ORF Clone, Rat, N-Myc tag RG80066-NM
    CXCL7 qPCR Primer Pairs, Rat RP300064

    CXCL7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL7 cDNA ORF Clone in Cloning Vector, Mouse MG50145-M
    CXCL7 cDNA ORF Clone, Mouse, untagged MG50145-UT
    CXCL7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50145-ACG
    CXCL7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50145-ACGLN
    CXCL7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50145-ACR
    CXCL7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50145-CF
    CXCL7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50145-NF
    CXCL7 cDNA ORF Clone, Mouse, C-His tag MG50145-CH
    CXCL7 cDNA ORF Clone, Mouse, C-HA tag MG50145-CY
    CXCL7 cDNA ORF Clone, Mouse, N-HA tag MG50145-NY
    CXCL7 cDNA ORF Clone, Mouse, C-Myc tag MG50145-CM
    CXCL7 cDNA ORF Clone, Mouse, N-Myc tag MG50145-NM
    CXCL7 qPCR Primer Pairs, Mouse MP200175

    CXCL7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL7 cDNA ORF Clone in Cloning Vector, Human HG10878-M
    CXCL7 cDNA ORF Clone, Human, untagged HG10878-UT
    CXCL7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10878-ACG
    CXCL7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10878-ACGLN
    CXCL7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10878-ACR
    CXCL7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10878-CF
    CXCL7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10878-NF
    CXCL7 cDNA ORF Clone, Human, C-His tag HG10878-CH
    CXCL7 cDNA ORF Clone, Human, N-His tag HG10878-NH
    CXCL7 cDNA ORF Clone, Human, C-HA tag HG10878-CY
    CXCL7 cDNA ORF Clone, Human, N-HA tag HG10878-NY
    CXCL7 cDNA ORF Clone, Human, C-Myc tag HG10878-CM
    CXCL7 cDNA ORF Clone, Human, N-Myc tag HG10878-NM
    CXCL7 qPCR Primer Pairs, Human HP100764
    info info
    添加购物车成功! 添加购物车失败!