CXCL4 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50144-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CXCL4 Reagents
CRO Services
Product recommended

All CXCL4 Reagents
CXCL4 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Mouse platelet factor 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL4 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Cxcl4 cDNA ORF Clone, Mouse;Scyb4 cDNA ORF Clone, Mouse
CXCL4 Background Information

Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the CXC chemokine family. CXCL4/PF4 is released from the alpha-granules of activated platelets and binds with high affinity to heparin. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, CXCL4/PF4 probably has a role in inflammation and wound repair. This protein is released during platelet aggregation. CXCL4/PF4 neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. CXCL4 is chemotactic for neutrophils and monocytes. It inhibits endothelial cell proliferation, the short form is a more potent inhibitor than the longer form. CXCL4/PF4 is up-regulated in human liver fibrosis and that it plays a nonredundant, functional role in experimental liver fibrosis by mediating stellate cell proliferation, migration, and intrahepatic immune cell recruitment.

Full Name
platelet factor 4
References
  • Zaldivar MM, et al. (2010) CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 51(4): 1345-53.
  • Lasagni L, et al. (2007) PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion. Blood. 109(10): 4127-34.
  • Struyf S, et al. (2004) Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 95(9): 855-7.
  • CXCL4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL4 cDNA ORF Clone in Cloning Vector, Mouse MG50144-M
    CXCL4 cDNA ORF Clone, Mouse, untagged MG50144-UT
    CXCL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50144-ACGLN
    CXCL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50144-ACG
    CXCL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50144-ACR
    CXCL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50144-CF
    CXCL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50144-NF
    CXCL4 cDNA ORF Clone, Mouse, C-His tag MG50144-CH
    CXCL4 cDNA ORF Clone, Mouse, C-HA tag MG50144-CY
    CXCL4 cDNA ORF Clone, Mouse, N-HA tag MG50144-NY
    CXCL4 cDNA ORF Clone, Mouse, C-Myc tag MG50144-CM
    CXCL4 cDNA ORF Clone, Mouse, N-Myc tag MG50144-NM
    CXCL4 qPCR Primer Pairs, Mouse MP200174

    CXCL4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL4 cDNA ORF Clone in Cloning Vector, Human HG10874-M
    CXCL4 cDNA ORF Clone, Human, untagged HG10874-UT
    CXCL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10874-ACGLN
    CXCL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10874-ACG
    CXCL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10874-ACR
    CXCL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10874-CF
    CXCL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10874-NF
    CXCL4 cDNA ORF Clone, Human, C-His tag HG10874-CH
    CXCL4 cDNA ORF Clone, Human, N-His tag HG10874-NH
    CXCL4 cDNA ORF Clone, Human, C-HA tag HG10874-CY
    CXCL4 cDNA ORF Clone, Human, N-HA tag HG10874-NY
    CXCL4 cDNA ORF Clone, Human, C-Myc tag HG10874-CM
    CXCL4 cDNA ORF Clone, Human, N-Myc tag HG10874-NM
    CXCL4 qPCR Primer Pairs, Human HP100761
    info info
    添加购物车成功! 添加购物车失败!