Cathepsin S cDNA ORF Clone, Mouse, untagged

Cat: MG51402-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin S Reagents
CRO Services
Product recommended

All Cathepsin S Reagents
Cathepsin S cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1023 bp
Description
Full length Clone DNA of Mouse cathepsin S.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin S cDNA ORF Clone, Mouse, untagged Alternative Names
Cat S cDNA ORF Clone, Mouse;Cats cDNA ORF Clone, Mouse
Cathepsin S Background Information

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

Full Name
cathepsin S
References
  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Cathepsin S cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin S cDNA ORF Clone in Cloning Vector, Rat RG80443-G
    Cathepsin S cDNA ORF Clone, Rat, untagged RG80443-UT
    Cathepsin S cDNA ORF Clone, Rat, C-GFPSpark® tag RG80443-ACG
    Cathepsin S Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80443-ACGLN
    Cathepsin S cDNA ORF Clone, Rat, C-OFPSpark® tag RG80443-ACR
    Cathepsin S cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80443-CF
    Cathepsin S cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80443-NF
    Cathepsin S cDNA ORF Clone, Rat, C-His tag RG80443-CH
    Cathepsin S cDNA ORF Clone, Rat, N-His tag RG80443-NH
    Cathepsin S cDNA ORF Clone, Rat, C-HA tag RG80443-CY
    Cathepsin S cDNA ORF Clone, Rat, N-HA tag RG80443-NY
    Cathepsin S cDNA ORF Clone, Rat, C-Myc tag RG80443-CM
    Cathepsin S cDNA ORF Clone, Rat, N-Myc tag RG80443-NM
    Cathepsin S qPCR Primer Pairs, Rat RP300412

    Cathepsin S cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin S cDNA ORF Clone in Cloning Vector, Mouse MG51402-G
    Cathepsin S cDNA ORF Clone in Cloning Vector, Mouse MG50769-G
    Cathepsin S cDNA ORF Clone, Mouse, untagged MG50769-UT
    Cathepsin S Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51402-ACGLN
    Cathepsin S cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51402-ACG
    Cathepsin S Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50769-ACGLN
    Cathepsin S cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50769-ACG
    Cathepsin S cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50769-ACR
    Cathepsin S cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51402-ACR
    Cathepsin S cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51402-CF
    Cathepsin S cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50769-CF
    Cathepsin S cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51402-NF
    Cathepsin S cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50769-NF
    Cathepsin S cDNA ORF Clone, Mouse, C-His tag MG50769-CH
    Cathepsin S cDNA ORF Clone, Mouse, C-His tag MG51402-CH
    Cathepsin S cDNA ORF Clone, Mouse, N-His tag MG50769-NH
    Cathepsin S cDNA ORF Clone, Mouse, N-His tag MG51402-NH
    Cathepsin S cDNA ORF Clone, Mouse, C-HA tag MG51402-CY
    Cathepsin S cDNA ORF Clone, Mouse, C-HA tag MG50769-CY
    Cathepsin S cDNA ORF Clone, Mouse, N-HA tag MG51402-NY
    Cathepsin S cDNA ORF Clone, Mouse, N-HA tag MG50769-NY
    Cathepsin S cDNA ORF Clone, Mouse, C-Myc tag MG50769-CM
    Cathepsin S cDNA ORF Clone, Mouse, C-Myc tag MG51402-CM
    Cathepsin S cDNA ORF Clone, Mouse, N-Myc tag MG50769-NM
    Cathepsin S cDNA ORF Clone, Mouse, N-Myc tag MG51402-NM
    Cathepsin S qPCR Primer Pairs, Mouse MP200743

    Cathepsin S cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin S cDNA ORF Clone in Cloning Vector, Human HG10487-U
    Cathepsin S cDNA ORF Clone, Human, untagged HG10487-UT
    Cathepsin S cDNA ORF Clone, Human, C-GFPSpark® tag HG10487-ACG
    Cathepsin S Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10487-ACGLN
    Cathepsin S cDNA ORF Clone, Human, C-OFPSpark® tag HG10487-ACR
    Cathepsin S cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10487-CF
    Cathepsin S cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10487-NF
    Cathepsin S cDNA ORF Clone, Human, C-His tag HG10487-CH
    Cathepsin S cDNA ORF Clone, Human, N-His tag HG10487-NH
    Cathepsin S cDNA ORF Clone, Human, C-HA tag HG10487-CY
    Cathepsin S cDNA ORF Clone, Human, N-HA tag HG10487-NY
    Cathepsin S cDNA ORF Clone, Human, C-Myc tag HG10487-CM
    Cathepsin S cDNA ORF Clone, Human, N-Myc tag HG10487-NM
    Cathepsin S qPCR Primer Pairs, Human HP100509
    info info
    添加购物车成功! 添加购物车失败!