Cathepsin H cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50619-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin H Reagents
CRO Services
Product recommended

All Cathepsin H Reagents
Cathepsin H cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse cathepsin H with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin H cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AL022844 cDNA ORF Clone, Mouse
Cathepsin H Background Information
Full Name
cathepsin H

Cathepsin H cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cathepsin H cDNA ORF Clone in Cloning Vector, Rat RG80883-U
Cathepsin H cDNA ORF Clone, Rat, untagged RG80883-UT
Cathepsin H cDNA ORF Clone, Rat, C-GFPSpark® tag RG80883-ACG
Cathepsin H Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80883-ACGLN
Cathepsin H cDNA ORF Clone, Rat, C-OFPSpark® tag RG80883-ACR
Cathepsin H cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80883-CF
Cathepsin H cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80883-NF
Cathepsin H cDNA ORF Clone, Rat, C-His tag RG80883-CH
Cathepsin H cDNA ORF Clone, Rat, N-His tag RG80883-NH
Cathepsin H cDNA ORF Clone, Rat, C-HA tag RG80883-CY
Cathepsin H cDNA ORF Clone, Rat, N-HA tag RG80883-NY
Cathepsin H cDNA ORF Clone, Rat, C-Myc tag RG80883-CM
Cathepsin H cDNA ORF Clone, Rat, N-Myc tag RG80883-NM
Cathepsin H qPCR Primer Pairs, Rat RP300847

Cathepsin H cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cathepsin H cDNA ORF Clone in Cloning Vector, Mouse MG50619-M
Cathepsin H cDNA ORF Clone, Mouse, untagged MG50619-UT
Cathepsin H cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50619-ACG
Cathepsin H Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50619-ACGLN
Cathepsin H cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50619-ACR
Cathepsin H cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50619-CF
Cathepsin H cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50619-NF
Cathepsin H cDNA ORF Clone, Mouse, C-His tag MG50619-CH
Cathepsin H cDNA ORF Clone, Mouse, N-His tag MG50619-NH
Cathepsin H cDNA ORF Clone, Mouse, N-HA tag MG50619-NY
Cathepsin H cDNA ORF Clone, Mouse, C-Myc tag MG50619-CM
Cathepsin H cDNA ORF Clone, Mouse, N-Myc tag MG50619-NM
Cathepsin H qPCR Primer Pairs, Mouse MP200604

Cathepsin H cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cathepsin H cDNA ORF Clone, Human, untagged HG12369-UT
Cathepsin H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12369-ACGLN
Cathepsin H qPCR Primer Pairs, Human HP104730
info info
添加购物车成功! 添加购物车失败!