Quick Order

Mouse CTSE ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse CTSE cDNA Clone Product Information
NCBI RefSeq:BC005432.1
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Mus musculus cathepsin E with C terminal His tag.
Gene Synonym:CE; CatE; A430072O03Rik; C920004C08Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Cathepsin E Protein (CTSE Protein) is a member of the peptidase C1 family that is a gastric aspartic protease that functions as a disulfide-linked homodimer. Cathepsin E Protein (CTSE Protein) is predominantly present in the cells of immune system and is frequently implicated in antigen processing via the MHC classⅡ pathway which however does not appear to be involved in the digestion of dietary protein. The protein has a specificity similar to that of pepsin and pepsin. Cathepsin E Protein (CTSE Protein) is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach and also been found in more than half of the gastric cancers. It appears, therefore, to be an oncofetal antigen.

References
  • Zaidi N, et al. (2008) Emerging functional foles of cathepsin E. Biochem Biophys Res Commun. 377(2) : 327-30.
  • Zaidi N, et al. (2008) Cathepsin E: a mini review. Biochem Biophys Res Commun. 367(3) :517-22.
  • Azuma T, et al. (1989) Human gastric cathepsin E Predicted sequence, localization to chromosome 1, and sequence homology with other aspartic proteinases.The journal of biological chemistry. 264: 16748-53.
  • Size / Price
    Catalog: MG50564-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"