Quick Order

Mouse Cathepsin C/CTSC Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse CTSC cDNA Clone Product Information
    NCBI RefSeq:NM_009982.4
    RefSeq ORF Size:1389bp
    cDNA Description:Full length Clone DNA of Mus musculus cathepsin C with C terminal His tag.
    Gene Synonym:DPP1, DPPI, AI047818
    Species:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTSC qPCR primers for gene expression analysis, MP200007 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

    References
  • Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.
  • Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.
  • Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.
  • Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.
  • Size / Price
    Catalog: MG50007-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"