CTGF/CCN2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51217-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CTGF/CCN2 Reagents
CRO Services
Product recommended

All CTGF/CCN2 Reagents
CTGF/CCN2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Mouse connective tissue growth factor with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTGF/CCN2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
Ccn2 cDNA ORF Clone, Mouse;fisp-12 cDNA ORF Clone, Mouse;Fisp12 cDNA ORF Clone, Mouse;Hcs24 cDNA ORF Clone, Mouse
CTGF/CCN2 Background Information
Full Name
connective tissue growth factor

CTGF/CCN2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CTGF/CCN2 cDNA ORF Clone in Cloning Vector, Mouse MG51217-U
CTGF/CCN2 cDNA ORF Clone, Mouse, untagged MG51217-UT
CTGF/CCN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51217-ACG
CTGF/CCN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51217-ACGLN
CTGF/CCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51217-ACR
CTGF/CCN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51217-CF
CTGF/CCN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51217-NF
CTGF/CCN2 cDNA ORF Clone, Mouse, N-His tag MG51217-NH
CTGF/CCN2 cDNA ORF Clone, Mouse, C-HA tag MG51217-CY
CTGF/CCN2 cDNA ORF Clone, Mouse, N-HA tag MG51217-NY
CTGF/CCN2 cDNA ORF Clone, Mouse, C-Myc tag MG51217-CM
CTGF/CCN2 cDNA ORF Clone, Mouse, N-Myc tag MG51217-NM
CTGF/CCN2 qPCR Primer Pairs, Mouse MP201101

CTGF/CCN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CTGF/CCN2 cDNA ORF Clone in Cloning Vector, Human HG13612-G
CTGF/CCN2 cDNA ORF Clone, Human, untagged HG13612-UT
CTGF/CCN2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13612-ACG
CTGF/CCN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13612-ACGLN
CTGF/CCN2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13612-ACR
CTGF/CCN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13612-CF
CTGF/CCN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13612-NF
CTGF/CCN2 cDNA ORF Clone, Human, C-His tag HG13612-CH
CTGF/CCN2 cDNA ORF Clone, Human, N-His tag HG13612-NH
CTGF/CCN2 cDNA ORF Clone, Human, C-HA tag HG13612-CY
CTGF/CCN2 cDNA ORF Clone, Human, N-HA tag HG13612-NY
CTGF/CCN2 cDNA ORF Clone, Human, C-Myc tag HG13612-CM
CTGF/CCN2 cDNA ORF Clone, Human, N-Myc tag HG13612-NM
CTGF/CCN2 qPCR Primer Pairs, Human HP102297
info info
添加购物车成功! 添加购物车失败!