CstF-64 cDNA ORF Clone, Mouse, untagged

Cat: MG52577-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CstF-64 Reagents
CRO Services
Product recommended

All CstF-64 Reagents
CstF-64 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1899 bp
Description
Full length Clone DNA of Mouse cleavage stimulation factor, 3' pre-RNA subunit 2, tau.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CstF-64 cDNA ORF Clone, Mouse, untagged Alternative Names
64kDa cDNA ORF Clone, Mouse;C77975 cDNA ORF Clone, Mouse;tauCstF-64 cDNA ORF Clone, Mouse;tCstF-64 cDNA ORF Clone, Mouse
CstF-64 Background Information
Full Name
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant

CstF-64 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CstF-64 cDNA ORF Clone in Cloning Vector, Mouse MG52577-G
CstF-64 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52577-ACG
CstF-64 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52577-ACGLN
CstF-64 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52577-ANG
CstF-64 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52577-ACR
CstF-64 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52577-ANR
CstF-64 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52577-CF
CstF-64 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52577-NF
CstF-64 cDNA ORF Clone, Mouse, C-His tag MG52577-CH
CstF-64 cDNA ORF Clone, Mouse, N-His tag MG52577-NH
CstF-64 cDNA ORF Clone, Mouse, C-HA tag MG52577-CY
CstF-64 cDNA ORF Clone, Mouse, N-HA tag MG52577-NY
CstF-64 cDNA ORF Clone, Mouse, C-Myc tag MG52577-CM
CstF-64 cDNA ORF Clone, Mouse, N-Myc tag MG52577-NM
CstF-64 qPCR Primer Pairs, Mouse MP202448

CstF-64 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CstF-64 cDNA ORF Clone in Cloning Vector, Human HG11516-G
CstF-64 cDNA ORF Clone, Human, untagged HG11516-UT
CstF-64 cDNA ORF Clone, Human, C-GFPSpark® tag HG11516-ACG
CstF-64 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11516-ACGLN
CstF-64 cDNA ORF Clone, Human, N-GFPSpark® tag HG11516-ANG
CstF-64 cDNA ORF Clone, Human, C-OFPSpark® tag HG11516-ACR
CstF-64 cDNA ORF Clone, Human, N-OFPSpark® tag HG11516-ANR
CstF-64 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11516-CF
CstF-64 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11516-NF
CstF-64 cDNA ORF Clone, Human, C-His tag HG11516-CH
CstF-64 cDNA ORF Clone, Human, N-His tag HG11516-NH
CstF-64 cDNA ORF Clone, Human, C-HA tag HG11516-CY
CstF-64 cDNA ORF Clone, Human, N-HA tag HG11516-NY
CstF-64 cDNA ORF Clone, Human, C-Myc tag HG11516-CM
CstF-64 cDNA ORF Clone, Human, N-Myc tag HG11516-NM
CstF-64 qPCR Primer Pairs, Human HP101387
info info
添加购物车成功! 添加购物车失败!