Quick Order

Mouse Cystatin 7 / CST7 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CST7 cDNA Clone Product Information
NCBI RefSeq:NM_009977.2
RefSeq ORF Size:504bp
cDNA Description:Full length Clone DNA of Mus musculus cystatin F (leukocystatin) with N terminal Myc tag.
Gene Synonym:CMAP, MGC151424, MGC151426, Cst7
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.

Size / Price
Catalog: MG50236-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"