CSRP1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50532-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CSRP1 Reagents
CRO Services
Product recommended

All CSRP1 Reagents
CSRP1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Mouse cysteine and glycine-rich protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSRP1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AA408841 cDNA ORF Clone, Mouse;AA959891 cDNA ORF Clone, Mouse;AW545626 cDNA ORF Clone, Mouse;CRP1 cDNA ORF Clone, Mouse;Csrp cDNA ORF Clone, Mouse
CSRP1 Background Information

Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

Full Name
cysteine and glycine-rich protein 1
References
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • CSRP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CSRP1 cDNA ORF Clone in Cloning Vector, Rat RG80651-U
    CSRP1 cDNA ORF Clone, Rat, untagged RG80651-UT
    CSRP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80651-ACGLN
    CSRP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80651-ACG
    CSRP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80651-ANG
    CSRP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80651-ACR
    CSRP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80651-ANR
    CSRP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80651-CF
    CSRP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80651-NF
    CSRP1 cDNA ORF Clone, Rat, C-His tag RG80651-CH
    CSRP1 cDNA ORF Clone, Rat, N-His tag RG80651-NH
    CSRP1 cDNA ORF Clone, Rat, C-HA tag RG80651-CY
    CSRP1 cDNA ORF Clone, Rat, N-HA tag RG80651-NY
    CSRP1 cDNA ORF Clone, Rat, C-Myc tag RG80651-CM
    CSRP1 cDNA ORF Clone, Rat, N-Myc tag RG80651-NM
    CSRP1 qPCR Primer Pairs, Rat RP300615

    CSRP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CSRP1 cDNA ORF Clone in Cloning Vector, Mouse MG50532-M
    CSRP1 cDNA ORF Clone, Mouse, untagged MG50532-UT
    CSRP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50532-ACG
    CSRP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50532-ACGLN
    CSRP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50532-ANG
    CSRP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50532-ACR
    CSRP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50532-ANR
    CSRP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50532-CF
    CSRP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50532-NF
    CSRP1 cDNA ORF Clone, Mouse, C-His tag MG50532-CH
    CSRP1 cDNA ORF Clone, Mouse, N-His tag MG50532-NH
    CSRP1 cDNA ORF Clone, Mouse, N-HA tag MG50532-NY
    CSRP1 cDNA ORF Clone, Mouse, C-Myc tag MG50532-CM
    CSRP1 cDNA ORF Clone, Mouse, N-Myc tag MG50532-NM
    CSRP1 qPCR Primer Pairs, Mouse MP200524

    CSRP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CSRP1 cDNA ORF Clone in Cloning Vector, Human HG11201-M
    CSRP1 cDNA ORF Clone, Human, untagged HG11201-UT
    CSRP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11201-ACGLN
    CSRP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11201-ACG
    CSRP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11201-ANG
    CSRP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11201-ACR
    CSRP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11201-ANR
    CSRP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11201-CF
    CSRP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11201-NF
    CSRP1 cDNA ORF Clone, Human, C-His tag HG11201-CH
    CSRP1 cDNA ORF Clone, Human, N-His tag HG11201-NH
    CSRP1 cDNA ORF Clone, Human, C-HA tag HG11201-CY
    CSRP1 cDNA ORF Clone, Human, N-HA tag HG11201-NY
    CSRP1 cDNA ORF Clone, Human, C-Myc tag HG11201-CM
    CSRP1 cDNA ORF Clone, Human, N-Myc tag HG11201-NM
    CSRP1 qPCR Primer Pairs, Human HP101106
    info info
    添加购物车成功! 添加购物车失败!