CRYZL1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52578-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRYZL1 Reagents
CRO Services
Product recommended

All CRYZL1 Reagents
CRYZL1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Mouse crystallin, zeta (quinone reductase)-like 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRYZL1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2210407J23Rik cDNA ORF Clone, Mouse;2410006O11Rik cDNA ORF Clone, Mouse;QOH-1 cDNA ORF Clone, Mouse
CRYZL1 Background Information
Full Name
crystallin, zeta (quinone reductase)-like 1

CRYZL1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
CRYZL1 cDNA ORF Clone in Cloning Vector, Rabbit TG65055-G
CRYZL1 cDNA ORF Clone, Rabbit, untagged TG65055-UT
CRYZL1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65055-ACG
CRYZL1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65055-ANG
CRYZL1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65055-ACR
CRYZL1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65055-ANR
CRYZL1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65055-CF
CRYZL1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65055-NF
CRYZL1 cDNA ORF Clone, Rabbit, C-His tag TG65055-CH
CRYZL1 cDNA ORF Clone, Rabbit, N-His tag TG65055-NH
CRYZL1 cDNA ORF Clone, Rabbit, C-HA tag TG65055-CY
CRYZL1 cDNA ORF Clone, Rabbit, N-HA tag TG65055-NY
CRYZL1 cDNA ORF Clone, Rabbit, C-Myc tag TG65055-CM
CRYZL1 cDNA ORF Clone, Rabbit, N-Myc tag TG65055-NM

CRYZL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRYZL1 cDNA ORF Clone in Cloning Vector, Mouse MG52578-G
CRYZL1 cDNA ORF Clone, Mouse, untagged MG52578-UT
CRYZL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52578-ACGLN
CRYZL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52578-ACG
CRYZL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52578-ANG
CRYZL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52578-ACR
CRYZL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52578-ANR
CRYZL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52578-CF
CRYZL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52578-NF
CRYZL1 cDNA ORF Clone, Mouse, C-His tag MG52578-CH
CRYZL1 cDNA ORF Clone, Mouse, C-HA tag MG52578-CY
CRYZL1 cDNA ORF Clone, Mouse, N-HA tag MG52578-NY
CRYZL1 cDNA ORF Clone, Mouse, C-Myc tag MG52578-CM
CRYZL1 cDNA ORF Clone, Mouse, N-Myc tag MG52578-NM
CRYZL1 qPCR Primer Pairs, Mouse MP202449

CRYZL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRYZL1 cDNA ORF Clone in Cloning Vector, Human HG22969-U
CRYZL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22969-ACGLN
info info
添加购物车成功! 添加购物车失败!