CRMP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52348-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRMP1 Reagents
CRO Services
Product recommended

All CRMP1 Reagents
CRMP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Description
Full length Clone DNA of Mouse collapsin response mediator protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRMP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
CRMP-1 cDNA ORF Clone, Mouse;Dpysl1 cDNA ORF Clone, Mouse;DRP-1 cDNA ORF Clone, Mouse;ULIP-3 cDNA ORF Clone, Mouse;Ulip3 cDNA ORF Clone, Mouse
CRMP1 Background Information
Full Name
collapsin response mediator protein 1

CRMP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CRMP1 cDNA ORF Clone in Cloning Vector, Rat RG86137-U
CRMP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86137-ACGLN

CRMP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRMP1 cDNA ORF Clone in Cloning Vector, Mouse MG52348-G
CRMP1 cDNA ORF Clone, Mouse, untagged MG52348-UT
CRMP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52348-ACGLN
CRMP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52348-ACG
CRMP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52348-ANG
CRMP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52348-ACR
CRMP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52348-ANR
CRMP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52348-NF
CRMP1 cDNA ORF Clone, Mouse, C-His tag MG52348-CH
CRMP1 cDNA ORF Clone, Mouse, N-His tag MG52348-NH
CRMP1 cDNA ORF Clone, Mouse, C-HA tag MG52348-CY
CRMP1 cDNA ORF Clone, Mouse, N-HA tag MG52348-NY
CRMP1 cDNA ORF Clone, Mouse, C-Myc tag MG52348-CM
CRMP1 cDNA ORF Clone, Mouse, N-Myc tag MG52348-NM
CRMP1 qPCR Primer Pairs, Mouse MP202221

CRMP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRMP1 cDNA ORF Clone in Cloning Vector, Human HG11468-M
CRMP1 cDNA ORF Clone, Human, untagged HG11468-UT
CRMP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11468-ACGLN
CRMP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11468-ACG
CRMP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11468-ANG
CRMP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11468-ACR
CRMP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11468-ANR
CRMP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11468-CF
CRMP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11468-NF
CRMP1 cDNA ORF Clone, Human, C-His tag HG11468-CH
CRMP1 cDNA ORF Clone, Human, N-His tag HG11468-NH
CRMP1 cDNA ORF Clone, Human, C-HA tag HG11468-CY
CRMP1 cDNA ORF Clone, Human, N-HA tag HG11468-NY
CRMP1 cDNA ORF Clone, Human, C-Myc tag HG11468-CM
CRMP1 cDNA ORF Clone, Human, N-Myc tag HG11468-NM
CRMP1 qPCR Primer Pairs, Human HP101345
info info
添加购物车成功! 添加购物车失败!