Quick Order

Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CRIPT cDNA Clone Product Information
NCBI RefSeq:NM_019936.3
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Mus musculus cysteine-rich PDZ-binding protein.
Gene Synonym:AA589469; 1200020A08Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid on other vectors
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52570-ACG$225
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52570-ACR$225
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52570-ANG$225
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52570-ANR$225
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-Flag tagMG52570-CF$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-His tagMG52570-CH$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-Myc tagMG52570-CM$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-HA tagMG52570-CY$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone in cloning vectorMG52570-G$75
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Flag tagMG52570-NF$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-His tagMG52570-NH$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Myc tagMG52570-NM$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-HA tagMG52570-NY$195
Mouse CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmidMG52570-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

References
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catalog: MG52570-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"