CPT2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52682-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CPT2 Reagents
CRO Services
Product recommended

All CPT2 Reagents
CPT2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1977 bp
Description
Full length Clone DNA of Mouse carnitine palmitoyltransferase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPT2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI323697 cDNA ORF Clone, Mouse;CPTII cDNA ORF Clone, Mouse
CPT2 Background Information
Full Name
carnitine palmitoyltransferase 2

CPT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CPT2 cDNA ORF Clone in Cloning Vector, Rat RG83154-U
CPT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83154-ACGLN

CPT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPT2 cDNA ORF Clone in Cloning Vector, Mouse MG52682-G
CPT2 cDNA ORF Clone, Mouse, untagged MG52682-UT
CPT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52682-ACGLN
CPT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52682-ACG
CPT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52682-ANG
CPT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52682-ACR
CPT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52682-ANR
CPT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52682-CF
CPT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52682-NF
CPT2 cDNA ORF Clone, Mouse, C-His tag MG52682-CH
CPT2 cDNA ORF Clone, Mouse, C-HA tag MG52682-CY
CPT2 cDNA ORF Clone, Mouse, N-HA tag MG52682-NY
CPT2 cDNA ORF Clone, Mouse, C-Myc tag MG52682-CM
CPT2 cDNA ORF Clone, Mouse, N-Myc tag MG52682-NM
CPT2 qPCR Primer Pairs, Mouse MP202553

CPT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPT2 cDNA ORF Clone in Cloning Vector, Human HG18044-U
CPT2 cDNA ORF Clone, Human, untagged HG18044-UT
CPT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG18044-ACG
CPT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18044-ACGLN
CPT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG18044-ANG
CPT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG18044-ACR
CPT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG18044-ANR
CPT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18044-CF
CPT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18044-NF
CPT2 cDNA ORF Clone, Human, C-His tag HG18044-CH
CPT2 cDNA ORF Clone, Human, N-His tag HG18044-NH
CPT2 cDNA ORF Clone, Human, C-HA tag HG18044-CY
CPT2 cDNA ORF Clone, Human, N-HA tag HG18044-NY
CPT2 cDNA ORF Clone, Human, C-Myc tag HG18044-CM
CPT2 cDNA ORF Clone, Human, N-Myc tag HG18044-NM
info info
添加购物车成功! 添加购物车失败!