Carboxypeptidase B1 cDNA ORF Clone, Mouse, untagged

Cat: MG50386-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Carboxypeptidase B1 Reagents
CRO Services
Product recommended

All Carboxypeptidase B1 Reagents
Carboxypeptidase B1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Mouse carboxypeptidase B1 (tissue).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase B1 cDNA ORF Clone, Mouse, untagged Alternative Names
0910001A18Rik cDNA ORF Clone, Mouse;1810063F02Rik cDNA ORF Clone, Mouse;2210008M23Rik cDNA ORF Clone, Mouse;AI504870 cDNA ORF Clone, Mouse
Carboxypeptidase B1 Background Information

Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

Full Name
carboxypeptidase B1 (tissue)
References
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Carboxypeptidase B1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B1 cDNA ORF Clone in Cloning Vector, Rhesus CG90524-U
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, untagged CG90524-UT
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90524-ACG
    Carboxypeptidase B1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90524-ACGLN
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90524-ANG
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90524-ACR
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90524-ANR
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90524-CF
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90524-NF
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-His tag CG90524-CH
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-His tag CG90524-NH
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-HA tag CG90524-CY
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-HA tag CG90524-NY
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, C-Myc tag CG90524-CM
    Carboxypeptidase B1 cDNA ORF Clone, Rhesus, N-Myc tag CG90524-NM

    Carboxypeptidase B1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B1 cDNA ORF Clone in Cloning Vector, Mouse MG50386-M
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50386-ACG
    Carboxypeptidase B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50386-ACGLN
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50386-ACR
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50386-CF
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50386-NF
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-His tag MG50386-CH
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, N-His tag MG50386-NH
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-HA tag MG50386-CY
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, N-HA tag MG50386-NY
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, C-Myc tag MG50386-CM
    Carboxypeptidase B1 cDNA ORF Clone, Mouse, N-Myc tag MG50386-NM
    Carboxypeptidase B1 qPCR Primer Pairs, Mouse MP200405

    Carboxypeptidase B1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B1 cDNA ORF Clone in Cloning Vector, Human HG10501-M
    Carboxypeptidase B1 cDNA ORF Clone, Human, untagged HG10501-UT
    Carboxypeptidase B1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10501-ACGLN
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10501-ACG
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10501-ACR
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10501-CF
    Carboxypeptidase B1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10501-NF
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-His tag HG10501-CH
    Carboxypeptidase B1 cDNA ORF Clone, Human, N-His tag HG10501-NH
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-HA tag HG10501-CY
    Carboxypeptidase B1 cDNA ORF Clone, Human, N-HA tag HG10501-NY
    Carboxypeptidase B1 cDNA ORF Clone, Human, C-Myc tag HG10501-CM
    Carboxypeptidase B1 cDNA ORF Clone, Human, N-Myc tag HG10501-NM
    Carboxypeptidase B1 qPCR Primer Pairs, Human HP100522
    info info
    添加购物车成功! 添加购物车失败!