Quick Order

Mouse Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse CPA1 cDNA Clone Product Information
    NCBI RefSeq:NM_025350.3
    RefSeq ORF Size:1260bp
    cDNA Description:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
    Gene Synonym:Cpa, 0910001L12Rik, Cpa1
    Species:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPA1 qPCR primers for gene expression analysis, MP200457 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

    References
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Catalog: MG50448-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"