COX16 cDNA ORF Clone, Mouse, untagged

Cat: MG52495-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COX16 Reagents
CRO Services
Product recommended

All COX16 Reagents
COX16 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
321 bp
Description
Full length Clone DNA of Mouse cytochrome c oxidase assembly protein 16.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX16 cDNA ORF Clone, Mouse, untagged Alternative Names
1810020G14Rik cDNA ORF Clone, Mouse;1810055I05Rik cDNA ORF Clone, Mouse;BB388670 cDNA ORF Clone, Mouse
COX16 Background Information
Full Name
COX16 cytochrome c oxidase assembly homolog

COX16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX16 cDNA ORF Clone in Cloning Vector, Mouse MG52495-G
COX16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52495-ACGLN
COX16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52495-ACG
COX16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52495-ANG
COX16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52495-ACR
COX16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52495-ANR
COX16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52495-CF
COX16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52495-NF
COX16 cDNA ORF Clone, Mouse, C-His tag MG52495-CH
COX16 cDNA ORF Clone, Mouse, N-His tag MG52495-NH
COX16 cDNA ORF Clone, Mouse, C-HA tag MG52495-CY
COX16 cDNA ORF Clone, Mouse, N-HA tag MG52495-NY
COX16 cDNA ORF Clone, Mouse, C-Myc tag MG52495-CM
COX16 cDNA ORF Clone, Mouse, N-Myc tag MG52495-NM
COX16 qPCR Primer Pairs, Mouse MP202368

COX16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX16 cDNA ORF Clone in Cloning Vector, Human HG14318-G
COX16 cDNA ORF Clone, Human, untagged HG14318-UT
COX16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14318-ACGLN
COX16 cDNA ORF Clone, Human, C-GFPSpark® tag HG14318-ACG
COX16 cDNA ORF Clone, Human, N-GFPSpark® tag HG14318-ANG
COX16 cDNA ORF Clone, Human, C-OFPSpark® tag HG14318-ACR
COX16 cDNA ORF Clone, Human, N-OFPSpark® tag HG14318-ANR
COX16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14318-CF
COX16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14318-NF
COX16 cDNA ORF Clone, Human, C-His tag HG14318-CH
COX16 cDNA ORF Clone, Human, N-His tag HG14318-NH
COX16 cDNA ORF Clone, Human, C-HA tag HG14318-CY
COX16 cDNA ORF Clone, Human, N-HA tag HG14318-NY
COX16 cDNA ORF Clone, Human, C-Myc tag HG14318-CM
COX16 cDNA ORF Clone, Human, N-Myc tag HG14318-NM
COX16 qPCR Primer Pairs, Human HP102968
info info
添加购物车成功! 添加购物车失败!