COPS6 cDNA ORF Clone, Mouse, untagged

Cat: MG52490-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COPS6 Reagents
CRO Services
Product recommended

All COPS6 Reagents
COPS6 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
975 bp
Description
Full length Clone DNA of Mouse COP9 (constitutive photomorphogenic) homolog, subunit 6 (Arabidopsis thaliana).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPS6 cDNA ORF Clone, Mouse, untagged Alternative Names
Sgn3 cDNA ORF Clone, Mouse;VIP/MOV34 cDNA ORF Clone, Mouse
COPS6 Background Information
Full Name
COP9 signalosome subunit 6

COPS6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPS6 cDNA ORF Clone in Cloning Vector, Mouse MG52490-G
COPS6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52490-ACG
COPS6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52490-ACGLN
COPS6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52490-ANG
COPS6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52490-ACR
COPS6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52490-ANR
COPS6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52490-CF
COPS6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52490-NF
COPS6 cDNA ORF Clone, Mouse, C-His tag MG52490-CH
COPS6 cDNA ORF Clone, Mouse, N-His tag MG52490-NH
COPS6 cDNA ORF Clone, Mouse, C-HA tag MG52490-CY
COPS6 cDNA ORF Clone, Mouse, N-HA tag MG52490-NY
COPS6 cDNA ORF Clone, Mouse, C-Myc tag MG52490-CM
COPS6 cDNA ORF Clone, Mouse, N-Myc tag MG52490-NM
COPS6 qPCR Primer Pairs, Mouse MP202363

COPS6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPS6 cDNA ORF Clone in Cloning Vector, Human HG16752-U
COPS6 cDNA ORF Clone, Human, untagged HG16752-UT
COPS6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16752-ACG
COPS6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16752-ACGLN
COPS6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16752-ANG
COPS6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16752-ACR
COPS6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16752-ANR
COPS6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16752-CF
COPS6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16752-NF
COPS6 cDNA ORF Clone, Human, C-His tag HG16752-CH
COPS6 cDNA ORF Clone, Human, N-His tag HG16752-NH
COPS6 cDNA ORF Clone, Human, C-HA tag HG16752-CY
COPS6 cDNA ORF Clone, Human, N-HA tag HG16752-NY
COPS6 cDNA ORF Clone, Human, C-Myc tag HG16752-CM
COPS6 cDNA ORF Clone, Human, N-Myc tag HG16752-NM
info info
添加购物车成功! 添加购物车失败!