COPS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51781-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COPS4 Reagents
CRO Services
Product recommended

All COPS4 Reagents
COPS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Mouse COP9 (constitutive photomorphogenic) homolog, subunit 4 (Arabidopsis thaliana) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AW208976 cDNA ORF Clone, Mouse;D5Ertd774e cDNA ORF Clone, Mouse
COPS4 Background Information
Full Name
COP9 signalosome subunit 4

COPS4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COPS4 cDNA ORF Clone in Cloning Vector, Rat RG80518-U
COPS4 cDNA ORF Clone, Rat, untagged RG80518-UT
COPS4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80518-ACGLN
COPS4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80518-ACG
COPS4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80518-ANG
COPS4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80518-ACR
COPS4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80518-ANR
COPS4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80518-CF
COPS4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80518-NF
COPS4 cDNA ORF Clone, Rat, C-His tag RG80518-CH
COPS4 cDNA ORF Clone, Rat, N-His tag RG80518-NH
COPS4 cDNA ORF Clone, Rat, C-HA tag RG80518-CY
COPS4 cDNA ORF Clone, Rat, N-HA tag RG80518-NY
COPS4 cDNA ORF Clone, Rat, C-Myc tag RG80518-CM
COPS4 cDNA ORF Clone, Rat, N-Myc tag RG80518-NM
COPS4 qPCR Primer Pairs, Rat RP300482

COPS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPS4 cDNA ORF Clone in Cloning Vector, Mouse MG51781-U
COPS4 cDNA ORF Clone, Mouse, untagged MG51781-UT
COPS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51781-ACG
COPS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51781-ACGLN
COPS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51781-ANG
COPS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51781-ACR
COPS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51781-ANR
COPS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51781-NF
COPS4 cDNA ORF Clone, Mouse, C-His tag MG51781-CH
COPS4 cDNA ORF Clone, Mouse, N-His tag MG51781-NH
COPS4 cDNA ORF Clone, Mouse, C-HA tag MG51781-CY
COPS4 cDNA ORF Clone, Mouse, N-HA tag MG51781-NY
COPS4 cDNA ORF Clone, Mouse, C-Myc tag MG51781-CM
COPS4 cDNA ORF Clone, Mouse, N-Myc tag MG51781-NM
COPS4 qPCR Primer Pairs, Mouse MP201654

COPS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPS4 cDNA ORF Clone in Cloning Vector, Human HG16982-U
COPS4 cDNA ORF Clone, Human, untagged HG16982-UT
COPS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16982-ACGLN
COPS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16982-ACG
COPS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16982-ANG
COPS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16982-ACR
COPS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16982-ANR
COPS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16982-CF
COPS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16982-NF
COPS4 cDNA ORF Clone, Human, C-His tag HG16982-CH
COPS4 cDNA ORF Clone, Human, N-His tag HG16982-NH
COPS4 cDNA ORF Clone, Human, C-HA tag HG16982-CY
COPS4 cDNA ORF Clone, Human, N-HA tag HG16982-NY
COPS4 cDNA ORF Clone, Human, C-Myc tag HG16982-CM
COPS4 cDNA ORF Clone, Human, N-Myc tag HG16982-NM
info info
添加购物车成功! 添加购物车失败!