COPG cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52222-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COPG Reagents
CRO Services
Product recommended

All COPG Reagents
COPG cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2625 bp
Description
Full length Clone DNA of Mouse coatomer protein complex, subunit gamma 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPG cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AU019265 cDNA ORF Clone, Mouse;BC056168 cDNA ORF Clone, Mouse;Copg cDNA ORF Clone, Mouse;D6Ertd71e cDNA ORF Clone, Mouse;D6Wsu16e cDNA ORF Clone, Mouse
COPG Background Information
Full Name
coatomer protein complex, subunit gamma 1

COPG cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPG cDNA ORF Clone in Cloning Vector, Mouse MG52222-G
COPG cDNA ORF Clone, Mouse, untagged MG52222-UT
COPG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52222-ACGLN
COPG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52222-ACG
COPG cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52222-ANG
COPG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52222-ACR
COPG cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52222-ANR
COPG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52222-CF
COPG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52222-NF
COPG cDNA ORF Clone, Mouse, C-His tag MG52222-CH
COPG cDNA ORF Clone, Mouse, N-His tag MG52222-NH
COPG cDNA ORF Clone, Mouse, C-HA tag MG52222-CY
COPG cDNA ORF Clone, Mouse, C-Myc tag MG52222-CM
COPG cDNA ORF Clone, Mouse, N-Myc tag MG52222-NM
COPG qPCR Primer Pairs, Mouse MP202095

COPG cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPG cDNA ORF Clone in Cloning Vector, Human HG20570-U
COPG cDNA ORF Clone, Human, untagged HG20570-UT
COPG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20570-ACGLN
COPG cDNA ORF Clone, Human, C-GFPSpark® tag HG20570-ACG
COPG cDNA ORF Clone, Human, N-GFPSpark® tag HG20570-ANG
COPG cDNA ORF Clone, Human, C-OFPSpark® tag HG20570-ACR
COPG cDNA ORF Clone, Human, N-OFPSpark® tag HG20570-ANR
COPG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20570-CF
COPG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20570-NF
COPG cDNA ORF Clone, Human, C-His tag HG20570-CH
COPG cDNA ORF Clone, Human, N-His tag HG20570-NH
COPG cDNA ORF Clone, Human, C-HA tag HG20570-CY
COPG cDNA ORF Clone, Human, N-HA tag HG20570-NY
COPG cDNA ORF Clone, Human, C-Myc tag HG20570-CM
COPG cDNA ORF Clone, Human, N-Myc tag HG20570-NM
info info
添加购物车成功! 添加购物车失败!