epsilon-COP cDNA ORF Clone, Mouse, N-His tag

Cat: MG52914-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All epsilon-COP Reagents
CRO Services
Product recommended

All epsilon-COP Reagents
epsilon-COP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
972 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 474C/T,726A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse coatomer protein complex, subunit epsilon with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI(6kb+0.97kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
epsilon-COP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

epsilon-COP cDNA ORF Clone, Mouse, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
epsilon-COP cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110005D17Rik cDNA ORF Clone, Mouse;Cope1 cDNA ORF Clone, Mouse
epsilon-COP Background Information
Full Name
coatomer protein complex, subunit epsilon

epsilon-COP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
epsilon-COP cDNA ORF Clone in Cloning Vector, Rat RG81495-G

epsilon-COP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
epsilon-COP cDNA ORF Clone in Cloning Vector, Mouse MG52914-G
epsilon-COP cDNA ORF Clone, Mouse, untagged MG52914-UT
epsilon-COP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52914-ACGLN
epsilon-COP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52914-ACG
epsilon-COP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52914-ANG
epsilon-COP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52914-ACR
epsilon-COP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52914-ANR
epsilon-COP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52914-CF
epsilon-COP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52914-NF
epsilon-COP cDNA ORF Clone, Mouse, C-His tag MG52914-CH
epsilon-COP cDNA ORF Clone, Mouse, C-HA tag MG52914-CY
epsilon-COP cDNA ORF Clone, Mouse, N-HA tag MG52914-NY
epsilon-COP cDNA ORF Clone, Mouse, C-Myc tag MG52914-CM
epsilon-COP cDNA ORF Clone, Mouse, N-Myc tag MG52914-NM

epsilon-COP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
epsilon-COP cDNA ORF Clone in Cloning Vector, Human HG14265-G
epsilon-COP cDNA ORF Clone, Human, untagged HG14265-UT
epsilon-COP cDNA ORF Clone, Human, C-GFPSpark® tag HG14265-ACG
epsilon-COP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14265-ACGLN
epsilon-COP cDNA ORF Clone, Human, N-GFPSpark® tag HG14265-ANG
epsilon-COP cDNA ORF Clone, Human, C-OFPSpark® tag HG14265-ACR
epsilon-COP cDNA ORF Clone, Human, N-OFPSpark® tag HG14265-ANR
epsilon-COP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14265-CF
epsilon-COP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14265-NF
epsilon-COP cDNA ORF Clone, Human, C-His tag HG14265-CH
epsilon-COP cDNA ORF Clone, Human, N-His tag HG14265-NH
epsilon-COP cDNA ORF Clone, Human, C-HA tag HG14265-CY
epsilon-COP cDNA ORF Clone, Human, N-HA tag HG14265-NY
epsilon-COP cDNA ORF Clone, Human, C-Myc tag HG14265-CM
epsilon-COP cDNA ORF Clone, Human, N-Myc tag HG14265-NM
epsilon-COP qPCR Primer Pairs, Human HP102915
info info
添加购物车成功! 添加购物车失败!