COLEC12 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50085-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COLEC12 Reagents
CRO Services
Product recommended

All COLEC12 Reagents
COLEC12 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2229 bp
Description
Full length Clone DNA of Mouse collectin sub-family member 12 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COLEC12 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
CL-P1 cDNA ORF Clone, Mouse;Scara4 cDNA ORF Clone, Mouse;SRCL cDNA ORF Clone, Mouse
COLEC12 Background Information

CLP1, also known as COLEC12, is a scavenger receptor that displays several functions associated with host defense. It contains 1 C-type lectin domain and 3 collagen-like domains. CLP1 is strongly expressed in placenta and moderately expressed in heart, skeletal muscle, small intestine and lung. It promotes binding and phagocytosis of Gram-positive, Gram-negative bacteria and yeast. CLP1 mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. It binds to several carbohydrates including Gal-type ligands, D-galactose, L- and D-fucose, GalNAc, T and Tn antigens in a calcium-dependent manner and internalizes specifically GalNAc in nurse-like cells. It binds also to sialyl Lewis X or a trisaccharide and asialo-orosomucoid (ASOR). CLP1 may also play a role in the clearance of amyloid beta in Alzheimer disease.

Full Name
collectin sub-family member 12
References
  • Ramirez A, et al. (2008) Human RNA 5'-kinase (hClp1) can function as a tRNA splicing enzyme in vivo. RNA. 14(9):1737-45.
  • Danielsen JM, et al.. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  •  

    COLEC12 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    COLEC12 cDNA ORF Clone in Cloning Vector, Rat RG80394-G
    COLEC12 cDNA ORF Clone, Rat, untagged RG80394-UT
    COLEC12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80394-ACG
    COLEC12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80394-ACGLN
    COLEC12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80394-ACR
    COLEC12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80394-CF
    COLEC12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80394-NF
    COLEC12 cDNA ORF Clone, Rat, C-His tag RG80394-CH
    COLEC12 cDNA ORF Clone, Rat, N-His tag RG80394-NH
    COLEC12 cDNA ORF Clone, Rat, C-HA tag RG80394-CY
    COLEC12 cDNA ORF Clone, Rat, N-HA tag RG80394-NY
    COLEC12 cDNA ORF Clone, Rat, C-Myc tag RG80394-CM
    COLEC12 cDNA ORF Clone, Rat, N-Myc tag RG80394-NM
    COLEC12 qPCR Primer Pairs, Rat RP300360

    COLEC12 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    COLEC12 cDNA ORF Clone in Cloning Vector, Mouse MG50085-M
    COLEC12 cDNA ORF Clone, Mouse, untagged MG50085-UT
    COLEC12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50085-ACG
    COLEC12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50085-ACGLN
    COLEC12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50085-ACR
    COLEC12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50085-CF
    COLEC12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50085-NF
    COLEC12 cDNA ORF Clone, Mouse, C-His tag MG50085-CH
    COLEC12 cDNA ORF Clone, Mouse, N-His tag MG50085-NH
    COLEC12 cDNA ORF Clone, Mouse, C-HA tag MG50085-CY
    COLEC12 cDNA ORF Clone, Mouse, C-Myc tag MG50085-CM
    COLEC12 cDNA ORF Clone, Mouse, N-Myc tag MG50085-NM
    COLEC12 qPCR Primer Pairs, Mouse MP200115

    COLEC12 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    COLEC12 cDNA ORF Clone, Human, untagged HG11817-G-N
    COLEC12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11817-ACGLN
    COLEC12 qPCR Primer Pairs, Human HP104595
    info info
    添加购物车成功! 添加购物车失败!