CNOT8 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51505-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CNOT8 Reagents
CRO Services
Product recommended

All CNOT8 Reagents
CNOT8 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Mouse CCR4-NOT transcription complex, subunit 8 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNOT8 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1500015I04Rik cDNA ORF Clone, Mouse;1810022F04Rik cDNA ORF Clone, Mouse;AA536816 cDNA ORF Clone, Mouse;AU015770 cDNA ORF Clone, Mouse;AU043059 cDNA ORF Clone, Mouse
CNOT8 Background Information
Full Name
CCR4-NOT transcription complex, subunit 8

CNOT8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNOT8 cDNA ORF Clone in Cloning Vector, Mouse MG51505-G
CNOT8 cDNA ORF Clone, Mouse, untagged MG51505-UT
CNOT8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51505-ACG
CNOT8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51505-ACGLN
CNOT8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51505-ANG
CNOT8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51505-ACR
CNOT8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51505-ANR
CNOT8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51505-CF
CNOT8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51505-NF
CNOT8 cDNA ORF Clone, Mouse, C-His tag MG51505-CH
CNOT8 cDNA ORF Clone, Mouse, N-His tag MG51505-NH
CNOT8 cDNA ORF Clone, Mouse, C-HA tag MG51505-CY
CNOT8 cDNA ORF Clone, Mouse, N-HA tag MG51505-NY
CNOT8 cDNA ORF Clone, Mouse, C-Myc tag MG51505-CM
CNOT8 qPCR Primer Pairs, Mouse MP201389

CNOT8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNOT8 cDNA ORF Clone in Cloning Vector, Human HG19923-U
CNOT8 cDNA ORF Clone, Human, untagged HG19923-UT
CNOT8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19923-ACGLN
CNOT8 cDNA ORF Clone, Human, C-GFPSpark® tag HG19923-ACG
CNOT8 cDNA ORF Clone, Human, N-GFPSpark® tag HG19923-ANG
CNOT8 cDNA ORF Clone, Human, C-OFPSpark® tag HG19923-ACR
CNOT8 cDNA ORF Clone, Human, N-OFPSpark® tag HG19923-ANR
CNOT8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19923-CF
CNOT8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19923-NF
CNOT8 cDNA ORF Clone, Human, C-His tag HG19923-CH
CNOT8 cDNA ORF Clone, Human, N-His tag HG19923-NH
CNOT8 cDNA ORF Clone, Human, C-HA tag HG19923-CY
CNOT8 cDNA ORF Clone, Human, N-HA tag HG19923-NY
CNOT8 cDNA ORF Clone, Human, C-Myc tag HG19923-CM
CNOT8 cDNA ORF Clone, Human, N-Myc tag HG19923-NM
info info
添加购物车成功! 添加购物车失败!