Quick Order

Text Size:AAA

Mouse CMBL natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CMBL cDNA Clone Product Information
NCBI RefSeq:NM_181588.3
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Mus musculus carboxymethylenebutenolidase-like (Pseudomonas).
Gene Synonym:2310016A09Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

References
  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Size / Price
    Catalog: MG51405-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"