CLVS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51885-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLVS2 Reagents
CRO Services
Product recommended

All CLVS2 Reagents
CLVS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
984 bp
Description
Full length Clone DNA of Mouse clavesin 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLVS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
A330019N05Rik cDNA ORF Clone, Mouse;Rlbp1l2 cDNA ORF Clone, Mouse
CLVS2 Background Information
Full Name
clavesin 2

CLVS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLVS2 cDNA ORF Clone in Cloning Vector, Mouse MG51885-G
CLVS2 cDNA ORF Clone, Mouse, untagged MG51885-UT
CLVS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51885-ACG
CLVS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51885-ACGLN
CLVS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51885-ACR
CLVS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51885-CF
CLVS2 cDNA ORF Clone, Mouse, C-His tag MG51885-CH
CLVS2 cDNA ORF Clone, Mouse, N-His tag MG51885-NH
CLVS2 cDNA ORF Clone, Mouse, C-HA tag MG51885-CY
CLVS2 cDNA ORF Clone, Mouse, N-HA tag MG51885-NY
CLVS2 cDNA ORF Clone, Mouse, C-Myc tag MG51885-CM
CLVS2 cDNA ORF Clone, Mouse, N-Myc tag MG51885-NM
CLVS2 qPCR Primer Pairs, Mouse MP201758

CLVS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLVS2 cDNA ORF Clone in Cloning Vector, Human HG15725-G
CLVS2 cDNA ORF Clone, Human, untagged HG15725-UT
CLVS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15725-ACGLN
CLVS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15725-ACG
CLVS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15725-ACR
CLVS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15725-CF
CLVS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15725-NF
CLVS2 cDNA ORF Clone, Human, C-His tag HG15725-CH
CLVS2 cDNA ORF Clone, Human, N-His tag HG15725-NH
CLVS2 cDNA ORF Clone, Human, C-HA tag HG15725-CY
CLVS2 cDNA ORF Clone, Human, N-HA tag HG15725-NY
CLVS2 cDNA ORF Clone, Human, C-Myc tag HG15725-CM
CLVS2 cDNA ORF Clone, Human, N-Myc tag HG15725-NM
CLVS2 qPCR Primer Pairs, Human HP104318
info info
添加购物车成功! 添加购物车失败!