ASAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50553-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ASAM Reagents
CRO Services
Product recommended

All ASAM Reagents
ASAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1122 bp
Description
Full length Clone DNA of Mouse RIKEN c DNA.9030425E11 gene with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About ASAM
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
9030425E11Rik cDNA ORF Clone, Mouse;ACAM cDNA ORF Clone, Mouse;ASP5 cDNA ORF Clone, Mouse;AW557819 cDNA ORF Clone, Mouse
ASAM Background Information

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

Full Name
CXADR-like membrane protein
References
  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • ASAM cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ASAM cDNA ORF Clone in Cloning Vector, Rat RG80219-G
    ASAM cDNA ORF Clone, Rat, untagged RG80219-UT
    ASAM cDNA ORF Clone, Rat, C-GFPSpark® tag RG80219-ACG
    ASAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80219-ACGLN
    ASAM cDNA ORF Clone, Rat, C-OFPSpark® tag RG80219-ACR
    ASAM cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80219-CF
    ASAM cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80219-NF
    ASAM cDNA ORF Clone, Rat, C-His tag RG80219-CH
    ASAM cDNA ORF Clone, Rat, N-His tag RG80219-NH
    ASAM cDNA ORF Clone, Rat, C-HA tag RG80219-CY
    ASAM cDNA ORF Clone, Rat, N-HA tag RG80219-NY
    ASAM cDNA ORF Clone, Rat, C-Myc tag RG80219-CM
    ASAM cDNA ORF Clone, Rat, N-Myc tag RG80219-NM
    ASAM qPCR Primer Pairs, Rat RP300210

    ASAM cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ASAM cDNA ORF Clone in Cloning Vector, Mouse MG50553-M
    ASAM cDNA ORF Clone, Mouse, untagged MG50553-UT
    ASAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50553-ACGLN
    ASAM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50553-ACG
    ASAM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50553-ACR
    ASAM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50553-NF
    ASAM cDNA ORF Clone, Mouse, C-His tag MG50553-CH
    ASAM cDNA ORF Clone, Mouse, N-His tag MG50553-NH
    ASAM cDNA ORF Clone, Mouse, C-HA tag MG50553-CY
    ASAM cDNA ORF Clone, Mouse, N-HA tag MG50553-NY
    ASAM cDNA ORF Clone, Mouse, C-Myc tag MG50553-CM
    ASAM cDNA ORF Clone, Mouse, N-Myc tag MG50553-NM
    ASAM qPCR Primer Pairs, Mouse MP200545

    ASAM cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ASAM cDNA ORF Clone in Cloning Vector, Human HG10794-M
    ASAM cDNA ORF Clone, Human, untagged HG10794-UT
    ASAM cDNA ORF Clone, Human, C-GFPSpark® tag HG10794-ACG
    ASAM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10794-ACGLN
    ASAM cDNA ORF Clone, Human, C-OFPSpark® tag HG10794-ACR
    ASAM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10794-CF
    ASAM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10794-NF
    ASAM cDNA ORF Clone, Human, C-His tag HG10794-CH
    ASAM cDNA ORF Clone, Human, N-His tag HG10794-NH
    ASAM cDNA ORF Clone, Human, C-HA tag HG10794-CY
    ASAM cDNA ORF Clone, Human, N-HA tag HG10794-NY
    ASAM cDNA ORF Clone, Human, C-Myc tag HG10794-CM
    ASAM cDNA ORF Clone, Human, N-Myc tag HG10794-NM
    ASAM qPCR Primer Pairs, Human HP100708
    info info
    添加购物车成功! 添加购物车失败!