Dectin-1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50233-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Dectin-1 Reagents
CRO Services
Product recommended

All Dectin-1 Reagents
Dectin-1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Mouse C-type lectin domain family 7, member a with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Dectin-1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
beta-GR cDNA ORF Clone, Mouse;BGR cDNA ORF Clone, Mouse;Clecsf12 cDNA ORF Clone, Mouse
Dectin-1 Background Information

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

Full Name
C-type lectin domain family 7, member A
References
  • Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.
  • Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.
  • Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.
  • Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.
  • Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.
  • Dectin-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Dectin-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90153-G
    Dectin-1 cDNA ORF Clone, Rhesus, untagged CG90153-UT
    Dectin-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90153-ACGLN
    Dectin-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90153-ACG
    Dectin-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90153-ACR
    Dectin-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90153-CF
    Dectin-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90153-NF
    Dectin-1 cDNA ORF Clone, Rhesus, C-His tag CG90153-CH
    Dectin-1 cDNA ORF Clone, Rhesus, N-His tag CG90153-NH
    Dectin-1 cDNA ORF Clone, Rhesus, C-HA tag CG90153-CY
    Dectin-1 cDNA ORF Clone, Rhesus, N-HA tag CG90153-NY
    Dectin-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90153-CM
    Dectin-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90153-NM

    Dectin-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Dectin-1 cDNA ORF Clone in Cloning Vector, Mouse MG50233-M
    Dectin-1 cDNA ORF Clone, Mouse, untagged MG50233-UT
    Dectin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50233-ACG
    Dectin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50233-ACGLN
    Dectin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50233-ACR
    Dectin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50233-CF
    Dectin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50233-NF
    Dectin-1 cDNA ORF Clone, Mouse, C-His tag MG50233-CH
    Dectin-1 cDNA ORF Clone, Mouse, N-His tag MG50233-NH
    Dectin-1 cDNA ORF Clone, Mouse, C-HA tag MG50233-CY
    Dectin-1 cDNA ORF Clone, Mouse, N-HA tag MG50233-NY
    Dectin-1 cDNA ORF Clone, Mouse, C-Myc tag MG50233-CM
    Dectin-1 qPCR Primer Pairs, Mouse MP200260

    Dectin-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Dectin-1 cDNA ORF Clone in Cloning Vector, Human HG10215-M
    Dectin-1 cDNA ORF Clone, Human, untagged HG10215-UT
    Dectin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10215-ACGLN
    Dectin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10215-ACG
    Dectin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10215-ACR
    Dectin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10215-CF
    Dectin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10215-NF
    Dectin-1 cDNA ORF Clone, Human, C-His tag HG10215-CH
    Dectin-1 cDNA ORF Clone, Human, N-His tag HG10215-NH
    Dectin-1 cDNA ORF Clone, Human, C-HA tag HG10215-CY
    Dectin-1 cDNA ORF Clone, Human, N-HA tag HG10215-NY
    Dectin-1 cDNA ORF Clone, Human, C-Myc tag HG10215-CM
    Dectin-1 cDNA ORF Clone, Human, N-Myc tag HG10215-NM
    Dectin-1 qPCR Primer Pairs, Human HP100273
    info info
    添加购物车成功! 添加购物车失败!