Quick Order

Mouse Dectin-1/CLEC7A Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse CLEC7A cDNA Clone Product Information
NCBI RefSeq:NM_020008.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Mus musculus C-type lectin domain family 7, member a with N terminal His tag.
Gene Synonym:BGR, beta-GR, Clecsf12, Clec7a
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mCLEC7A
Restriction Site:KpnI + XbaI (6kb + 0.83kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CLEC7A Gene Plasmid Map
Mouse CLEC7A ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

References
  • Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.
  • Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.
  • Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.
  • Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.
  • Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.
  • Size / Price
    Catalog: MG50233-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse CLEC7A ORF mammalian expression plasmid, N-His tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"