CLEC4F cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50282-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLEC4F Reagents
CRO Services
Product recommended

All CLEC4F Reagents
CLEC4F cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1647 bp
Description
Full length Clone DNA of Mouse C-type lectin domain family 4, member f with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC4F cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Clecsf13 cDNA ORF Clone, Mouse;D18063 cDNA ORF Clone, Mouse;Kclr cDNA ORF Clone, Mouse;KUCR_MOUSE cDNA ORF Clone, Mouse
CLEC4F Background Information

CLEC4F, a member of C-type lectins, was firstly purified from rat liver extract with high binding affinity to fucose, galactose and N-acetylgalactosamine, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. Histochemical staining showed that mouse CLEC4F(mCLEC4F) is only expressed on F4/80+ cells localized in liver, and is undetectable in bone marrow, spleen, lymph nodes, or other tissues in adult mice. However, mCLEC4F is detected in the liver of embryonic day 11.5 (E11.5), which is 1.5 day earlier than the formation of liver (E10) and is 3.5 day earlier than the formation of bone marrow (E15-16). Moreover, recombinant mCLEC4F.Fc binds to alpha-galactoceramide in a Ca++-dependent manner, and both galactose and ceramide can partially inhibit CLEC4F.Fc binding to alpha-galactoceramide. Interestingly, mCLEC4F-deficient (mCEC4F k/o) mice produced far less cytokines than wild type littermates after intravenous injection ofalpha-galactoceramide. This suggests that mCLEC4F is not only a specific marker for Kupffer cells, but is also critical for the presentation of glycolipid antigen to NKT cells.

Full Name
C-type lectin domain family 4, member F
References
  • Shie-Liang Edmond Hsieh, et al. (2009) CLEC4F, A Kupffer Cells Specific Marker, Is Critical for Presentation of Alfa-Galactoceromide to NKT Cells. The Journal of Immunology. 182:78.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5.
  • Bonaldo MF, et al. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 1996 Sep;6(9):791-806.
  • CLEC4F cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CLEC4F cDNA ORF Clone in Cloning Vector, Rat RG80215-G
    CLEC4F cDNA ORF Clone, Rat, untagged RG80215-UT
    CLEC4F cDNA ORF Clone, Rat, C-GFPSpark® tag RG80215-ACG
    CLEC4F Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80215-ACGLN
    CLEC4F cDNA ORF Clone, Rat, C-OFPSpark® tag RG80215-ACR
    CLEC4F cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80215-CF
    CLEC4F cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80215-NF
    CLEC4F cDNA ORF Clone, Rat, C-His tag RG80215-CH
    CLEC4F cDNA ORF Clone, Rat, N-His tag RG80215-NH
    CLEC4F cDNA ORF Clone, Rat, C-HA tag RG80215-CY
    CLEC4F cDNA ORF Clone, Rat, N-HA tag RG80215-NY
    CLEC4F cDNA ORF Clone, Rat, C-Myc tag RG80215-CM
    CLEC4F cDNA ORF Clone, Rat, N-Myc tag RG80215-NM
    CLEC4F qPCR Primer Pairs, Rat RP300207

    CLEC4F cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLEC4F cDNA ORF Clone in Cloning Vector, Mouse MG50282-M
    CLEC4F cDNA ORF Clone, Mouse, untagged MG50282-UT
    CLEC4F Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50282-ACGLN
    CLEC4F cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50282-ACG
    CLEC4F cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50282-ACR
    CLEC4F cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50282-CF
    CLEC4F cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50282-NF
    CLEC4F cDNA ORF Clone, Mouse, C-His tag MG50282-CH
    CLEC4F cDNA ORF Clone, Mouse, N-His tag MG50282-NH
    CLEC4F cDNA ORF Clone, Mouse, C-HA tag MG50282-CY
    CLEC4F cDNA ORF Clone, Mouse, N-HA tag MG50282-NY
    CLEC4F cDNA ORF Clone, Mouse, C-Myc tag MG50282-CM
    CLEC4F qPCR Primer Pairs, Mouse MP200306

    CLEC4F cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLEC4F cDNA ORF Clone, Human, untagged HG11901-UT
    CLEC4F Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11901-ACGLN
    CLEC4F qPCR Primer Pairs, Human HP104669
    info info
    添加购物车成功! 添加购物车失败!