Tetranectin cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50700-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Tetranectin Reagents
CRO Services
Product recommended

All Tetranectin Reagents
Tetranectin cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Mouse C-type lectin domain family 3, member b with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tetranectin cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Tna cDNA ORF Clone, Mouse
Tetranectin Background Information

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

Full Name
C-type lectin domain family 3, member B
References
  • Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.
  • Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.
  • Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.
  • Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.
  • Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.
  • Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.
  • Tetranectin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Tetranectin cDNA ORF Clone in Cloning Vector, Mouse MG50700-M
    Tetranectin cDNA ORF Clone, Mouse, untagged MG50700-UT
    Tetranectin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50700-ACGLN
    Tetranectin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50700-ACG
    Tetranectin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50700-ACR
    Tetranectin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50700-CF
    Tetranectin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50700-NF
    Tetranectin cDNA ORF Clone, Mouse, C-His tag MG50700-CH
    Tetranectin cDNA ORF Clone, Mouse, N-His tag MG50700-NH
    Tetranectin cDNA ORF Clone, Mouse, C-HA tag MG50700-CY
    Tetranectin cDNA ORF Clone, Mouse, C-Myc tag MG50700-CM
    Tetranectin cDNA ORF Clone, Mouse, N-Myc tag MG50700-NM
    Tetranectin qPCR Primer Pairs, Mouse MP200675

    Tetranectin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Tetranectin cDNA ORF Clone in Cloning Vector, Human HG12735-M
    Tetranectin cDNA ORF Clone, Human, untagged HG12735-UT
    Tetranectin cDNA ORF Clone, Human, C-GFPSpark® tag HG12735-ACG
    Tetranectin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12735-ACGLN
    Tetranectin cDNA ORF Clone, Human, C-OFPSpark® tag HG12735-ACR
    Tetranectin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12735-CF
    Tetranectin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12735-NF
    Tetranectin cDNA ORF Clone, Human, C-His tag HG12735-CH
    Tetranectin cDNA ORF Clone, Human, N-His tag HG12735-NH
    Tetranectin cDNA ORF Clone, Human, C-HA tag HG12735-CY
    Tetranectin cDNA ORF Clone, Human, N-HA tag HG12735-NY
    Tetranectin cDNA ORF Clone, Human, C-Myc tag HG12735-CM
    Tetranectin cDNA ORF Clone, Human, N-Myc tag HG12735-NM
    Tetranectin qPCR Primer Pairs, Human HP101647
    info info
    添加购物车成功! 添加购物车失败!