CLEC3A cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50704-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLEC3A Reagents
CRO Services
Product recommended

All CLEC3A Reagents
CLEC3A cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse C-type lectin domain family 3, member a with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC3A cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110019O10Rik cDNA ORF Clone, Mouse;Clecsf1 cDNA ORF Clone, Mouse;Gm796 cDNA ORF Clone, Mouse
CLEC3A Background Information
Full Name
C-type lectin domain family 3, member A

CLEC3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLEC3A cDNA ORF Clone in Cloning Vector, Mouse MG50704-M
CLEC3A cDNA ORF Clone, Mouse, untagged MG50704-UT
CLEC3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50704-ACG
CLEC3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50704-ACGLN
CLEC3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50704-ACR
CLEC3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50704-CF
CLEC3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50704-NF
CLEC3A cDNA ORF Clone, Mouse, C-His tag MG50704-CH
CLEC3A cDNA ORF Clone, Mouse, N-His tag MG50704-NH
CLEC3A cDNA ORF Clone, Mouse, C-HA tag MG50704-CY
CLEC3A cDNA ORF Clone, Mouse, C-Myc tag MG50704-CM
CLEC3A cDNA ORF Clone, Mouse, N-Myc tag MG50704-NM
CLEC3A qPCR Primer Pairs, Mouse MP200679

CLEC3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLEC3A cDNA ORF Clone in Cloning Vector, Human HG11893-U
CLEC3A cDNA ORF Clone, Human, untagged HG11893-UT
CLEC3A cDNA ORF Clone, Human, C-GFPSpark® tag HG11893-ACG
CLEC3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11893-ACGLN
CLEC3A cDNA ORF Clone, Human, C-OFPSpark® tag HG11893-ACR
CLEC3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11893-CF
CLEC3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11893-NF
CLEC3A cDNA ORF Clone, Human, C-His tag HG11893-CH
CLEC3A cDNA ORF Clone, Human, N-His tag HG11893-NH
CLEC3A cDNA ORF Clone, Human, C-HA tag HG11893-CY
CLEC3A cDNA ORF Clone, Human, N-HA tag HG11893-NY
CLEC3A cDNA ORF Clone, Human, C-Myc tag HG11893-CM
CLEC3A cDNA ORF Clone, Human, N-Myc tag HG11893-NM
CLEC3A qPCR Primer Pairs, Human HP104663
info info
添加购物车成功! 添加购物车失败!