Quick Order

Mouse CLDN11 / Claudin-11 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CLDN11 cDNA Clone Product Information
NCBI RefSeq:NM_008770.3
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Mus musculus claudin 11.
Gene Synonym:Osp, Otm, Claudin11, Claudin-11
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.

References
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.
  • Size / Price
    Catalog: MG51441-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"