NNT1 cDNA ORF Clone, Mouse, untagged

Cat: MG50302-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NNT1 Reagents
CRO Services
Product recommended

All NNT1 Reagents
NNT1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Mouse cardiotrophin-like cytokine factor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NNT1 cDNA ORF Clone, Mouse, untagged Alternative Names
Bsf3 cDNA ORF Clone, Mouse;CLC cDNA ORF Clone, Mouse
NNT1 Background Information
Full Name
cardiotrophin-like cytokine factor 1

NNT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NNT1 cDNA ORF Clone in Cloning Vector, Mouse MG50302-M
NNT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50302-ACGLN
NNT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50302-ACG
NNT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50302-ACR
NNT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50302-CF
NNT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50302-NF
NNT1 cDNA ORF Clone, Mouse, C-His tag MG50302-CH
NNT1 cDNA ORF Clone, Mouse, N-His tag MG50302-NH
NNT1 cDNA ORF Clone, Mouse, C-HA tag MG50302-CY
NNT1 cDNA ORF Clone, Mouse, N-HA tag MG50302-NY
NNT1 cDNA ORF Clone, Mouse, C-Myc tag MG50302-CM
NNT1 cDNA ORF Clone, Mouse, N-Myc tag MG50302-NM
NNT1 qPCR Primer Pairs, Mouse MP200325

NNT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NNT1 cDNA ORF Clone in Cloning Vector, Human HG10937-M
NNT1 cDNA ORF Clone, Human, untagged HG10937-UT
NNT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10937-ACGLN
NNT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10937-ACG
NNT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10937-ACR
NNT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10937-CF
NNT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10937-NF
NNT1 cDNA ORF Clone, Human, C-His tag HG10937-CH
NNT1 cDNA ORF Clone, Human, N-His tag HG10937-NH
NNT1 cDNA ORF Clone, Human, C-HA tag HG10937-CY
NNT1 cDNA ORF Clone, Human, N-HA tag HG10937-NY
NNT1 cDNA ORF Clone, Human, C-Myc tag HG10937-CM
NNT1 cDNA ORF Clone, Human, N-Myc tag HG10937-NM
NNT1 qPCR Primer Pairs, Human HP100816
info info
添加购物车成功! 添加购物车失败!