CKMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53058-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CKMT2 Reagents
CRO Services
Product recommended

All CKMT2 Reagents
CKMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Mouse creatine kinase, mitochondrial 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2300008A19Rik cDNA ORF Clone, Mouse;ScCKmit cDNA ORF Clone, Mouse
CKMT2 Background Information
Full Name
creatine kinase, mitochondrial 2 (sarcomeric)

CKMT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Rat RG80619-U
CKMT2 cDNA ORF Clone, Rat, untagged RG80619-UT
CKMT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80619-ACGLN
CKMT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80619-ACG
CKMT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80619-ANG
CKMT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80619-ACR
CKMT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80619-ANR
CKMT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80619-CF
CKMT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80619-NF
CKMT2 cDNA ORF Clone, Rat, C-His tag RG80619-CH
CKMT2 cDNA ORF Clone, Rat, N-His tag RG80619-NH
CKMT2 cDNA ORF Clone, Rat, C-HA tag RG80619-CY
CKMT2 cDNA ORF Clone, Rat, N-HA tag RG80619-NY
CKMT2 cDNA ORF Clone, Rat, C-Myc tag RG80619-CM
CKMT2 cDNA ORF Clone, Rat, N-Myc tag RG80619-NM
CKMT2 qPCR Primer Pairs, Rat RP300583

CKMT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Mouse MG53058-G
CKMT2 cDNA ORF Clone, Mouse, untagged MG53058-UT
CKMT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53058-ACG
CKMT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53058-ACGLN
CKMT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53058-ACR
CKMT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53058-CF
CKMT2 cDNA ORF Clone, Mouse, C-His tag MG53058-CH
CKMT2 cDNA ORF Clone, Mouse, N-His tag MG53058-NH
CKMT2 cDNA ORF Clone, Mouse, C-HA tag MG53058-CY
CKMT2 cDNA ORF Clone, Mouse, N-HA tag MG53058-NY
CKMT2 cDNA ORF Clone, Mouse, C-Myc tag MG53058-CM
CKMT2 cDNA ORF Clone, Mouse, N-Myc tag MG53058-NM

CKMT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Human HG14453-G
CKMT2 cDNA ORF Clone, Human, untagged HG14453-UT
CKMT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14453-ACGLN
CKMT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14453-ACG
CKMT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14453-ANG
CKMT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14453-ACR
CKMT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14453-ANR
CKMT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14453-CF
CKMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14453-NF
CKMT2 cDNA ORF Clone, Human, C-His tag HG14453-CH
CKMT2 cDNA ORF Clone, Human, N-His tag HG14453-NH
CKMT2 cDNA ORF Clone, Human, C-HA tag HG14453-CY
CKMT2 cDNA ORF Clone, Human, N-HA tag HG14453-NY
CKMT2 cDNA ORF Clone, Human, C-Myc tag HG14453-CM
CKMT2 cDNA ORF Clone, Human, N-Myc tag HG14453-NM
CKMT2 qPCR Primer Pairs, Human HP103101
info info
添加购物车成功! 添加购物车失败!