CIDEA cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52226-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CIDEA Reagents
CRO Services
Product recommended

All CIDEA Reagents
CIDEA cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Mouse cell death-inducing DNA fragmentation factor, alpha subunit-like effector A with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CIDEA cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AW212747 cDNA ORF Clone, Mouse
CIDEA Background Information
Full Name
cell death-inducing DFFA-like effector a

CIDEA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CIDEA cDNA ORF Clone in Cloning Vector, Rat RG80430-G
CIDEA cDNA ORF Clone, Rat, untagged RG80430-UT
CIDEA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80430-ACGLN
CIDEA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80430-ACG
CIDEA cDNA ORF Clone, Rat, N-GFPSpark® tag RG80430-ANG
CIDEA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80430-ACR
CIDEA cDNA ORF Clone, Rat, N-OFPSpark® tag RG80430-ANR
CIDEA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80430-CF
CIDEA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80430-NF
CIDEA cDNA ORF Clone, Rat, C-His tag RG80430-CH
CIDEA cDNA ORF Clone, Rat, N-His tag RG80430-NH
CIDEA cDNA ORF Clone, Rat, C-HA tag RG80430-CY
CIDEA cDNA ORF Clone, Rat, N-HA tag RG80430-NY
CIDEA cDNA ORF Clone, Rat, C-Myc tag RG80430-CM
CIDEA cDNA ORF Clone, Rat, N-Myc tag RG80430-NM
CIDEA qPCR Primer Pairs, Rat RP300403

CIDEA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CIDEA cDNA ORF Clone in Cloning Vector, Mouse MG52226-G
CIDEA cDNA ORF Clone, Mouse, untagged MG52226-UT
CIDEA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52226-ACG
CIDEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52226-ACGLN
CIDEA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52226-ANG
CIDEA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52226-ACR
CIDEA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52226-ANR
CIDEA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52226-CF
CIDEA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52226-NF
CIDEA cDNA ORF Clone, Mouse, C-His tag MG52226-CH
CIDEA cDNA ORF Clone, Mouse, N-His tag MG52226-NH
CIDEA cDNA ORF Clone, Mouse, C-HA tag MG52226-CY
CIDEA cDNA ORF Clone, Mouse, C-Myc tag MG52226-CM
CIDEA cDNA ORF Clone, Mouse, N-Myc tag MG52226-NM
CIDEA qPCR Primer Pairs, Mouse MP202099

CIDEA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CIDEA cDNA ORF Clone, Human, untagged HG18992-UT
info info
添加购物车成功! 添加购物车失败!