After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CIB2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse CIB2 cDNA Clone Product Information
NCBI RefSeq:BC005739.1
RefSeq ORF Size:564bp
cDNA Description:Full length Clone DNA of Mus musculus calcium and integrin binding family member 2 with N terminal His tag.
Gene Synonym:AI449053, 2810434I23Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
  • Size / Price
    Catalog: MG52594-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"