CHST3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50577-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHST3 Reagents
CRO Services
Product recommended

All CHST3 Reagents
CHST3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1419 bp
Description
Full length Clone DNA of Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHST3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
C6ST cDNA ORF Clone, Mouse;C6ST-1 cDNA ORF Clone, Mouse;GST-0 cDNA ORF Clone, Mouse
CHST3 Background Information

Carbohydrate sulfotransferase 3, also known as Chondroitin 6-O-sulfotransferase 1, Chondroitin 6-sulfotransferase and CHST3, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family and Gal / GlcNAc / GalNAc subfamily. CHST3 is widely expressed in adult tissues. It is expressed in heart, placenta, skeletal muscle and pancreas. CHST3 is also expressed in various immune tissues such as spleen, lymph node, thymus and appendix. CHST3 catalyzes the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. It is a chondroitin sulfate which constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. It can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. It may play a role in the maintenance of naive T-lymphocytes in the spleen. Defects in CHST3 are the cause of spondyloepiphyseal dysplasia Omani type (SED Omani type) which is an autosomal recessive disorder characterized by normal length at birth but severely reduced adult height (110-130 cm), severe progressive kyphoscoliosis, arthritic changes with joint dislocations, genu valgum, cubitus valgus, mild brachydactyly, camptodactyly, microdontia and normal intelligence. As a consequence of the arthropathy and the contractures, affected individuals develop restricted joint movement. Defects in CHST3 are also a cause of humerospinal dysostosis (HSD) which is characterized by bifurcation of the ends of the humerus, subluxation in the elbow joints, widened iliac bones, talipes equinovarus and coronal cleft vertebrae. Congenital, progressive heart disease, possibly with fatal outcome, is observed in some patients.

Full Name
carbohydrate (chondroitin 6) sulfotransferase 3
References
  • Fukuta M., et al., 1998, Biochim. Biophys. Acta 1399:57-61.
  • Tsutsumi K., et al., 1998, FEBS Lett. 441:235-241.
  • Thiele H., et al., 2004, Proc. Natl. Acad. Sci. USA. 101:10155-10160.
  • Hermanns P., et al., 2008, Am. J. Hum. Genet. 82:1368-1374.
  • info info
    添加购物车成功! 添加购物车失败!