Quick Order

Mouse CHST3 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse CHST3 cDNA Clone Product Information
NCBI RefSeq:NM_016803.2
RefSeq ORF Size:1419bp
cDNA Description:Full length Clone DNA of Mus musculus carbohydrate (chondroitin 6/keratan) sulfotransferase 3 with C terminal HA tag.
Gene Synonym:C6ST, GST-0, C6ST-1, Chst3
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse carbohydrate sulfotransferase 3, also known as Chondroitin 6-O-sulfotransferase 1, Chondroitin 6-sulfotransferase and CHST3, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family and Gal / GlcNAc / GalNAc subfamily. CHST3 is widely expressed in adult tissues. It is expressed in heart, placenta, skeletal muscle and pancreas. CHST3 is also expressed in various immune tissues such as spleen, lymph node, thymus and appendix. CHST3 catalyzes the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. It is a chondroitin sulfate which constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. It can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. It may play a role in the maintenance of naive T-lymphocytes in the spleen. Defects in CHST3 are the cause of spondyloepiphyseal dysplasia Omani type (SED Omani type) which is an autosomal recessive disorder characterized by normal length at birth but severely reduced adult height (110-130 cm), severe progressive kyphoscoliosis, arthritic changes with joint dislocations, genu valgum, cubitus valgus, mild brachydactyly, camptodactyly, microdontia and normal intelligence. As a consequence of the arthropathy and the contractures, affected individuals develop restricted joint movement. Defects in CHST3 are also a cause of humerospinal dysostosis (HSD) which is characterized by bifurcation of the ends of the humerus, subluxation in the elbow joints, widened iliac bones, talipes equinovarus and coronal cleft vertebrae. Congenital, progressive heart disease, possibly with fatal outcome, is observed in some patients.

References
  • Fukuta M., et al., 1998, Biochim. Biophys. Acta 1399:57-61.
  • Tsutsumi K., et al., 1998, FEBS Lett. 441:235-241.
  • Thiele H., et al., 2004, Proc. Natl. Acad. Sci. USA. 101:10155-10160.
  • Hermanns P., et al., 2008, Am. J. Hum. Genet. 82:1368-1374.
  • Size / Price
    Catalog: MG50577-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"