CHRDL1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50868-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHRDL1 Reagents
CRO Services
Product recommended

All CHRDL1 Reagents
CHRDL1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse chordin-like 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHRDL1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
CHL cDNA ORF Clone, Mouse;CHL1 cDNA ORF Clone, Mouse;Nrln1 cDNA ORF Clone, Mouse;VOPT cDNA ORF Clone, Mouse
CHRDL1 Background Information

Cordin-like 1 (CHRDL1) is an antagonist of bone morphogenetic protein 4. It may play a role in topographic retinotectal projection and in the regulation of retinal angiogenesis in response to hypoxia. Cordin-like 1 (CHRDL1) is an inhibitor of the bone morphogenetic proteins (BMPs) that have functions in inducing ectopic bone formation. CHRDL1 acheves its inhibiting ability through affecting the osteogenic differentiation of MC3T3-E1 cells. Besides its function as an antagonist, CHRDL1 enhanced the proliferation of human mesenchymal stem cells in a BMP2-independent manner.

Full Name
chordin-like 1
References
  • Fernandes H, et al. (2010) Effect of chordin-like 1 on MC3T3-E1 and human mesenchymal stem cells. Cells Tissues Organs. 191 (6): 443-52.
  • Larman BW, et al. (2009) Chordin-like 1 and twisted gastrulation 1 regulate BMP signaling following kidney injury. J Am Soc Nephrol. 20 (5): 1020-31.
  • Kane R, et al. (2008) Chordin-like 1, a bone morphogenetic protein-4 antagonist, is upregulated by hypoxia in human retinal pericytes and plays a role in regulating angiogenesis. Mol Vis. 14: 1138-48.
  •  

    Chordin-Like 1/CHRDL1 related areas, pathways, and other information

    CHRDL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CHRDL1 cDNA ORF Clone in Cloning Vector, Mouse MG50868-G
    CHRDL1 cDNA ORF Clone, Mouse, untagged MG50868-UT
    CHRDL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50868-ACGLN
    CHRDL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50868-ACG
    CHRDL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50868-ACR
    CHRDL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50868-CF
    CHRDL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50868-NF
    CHRDL1 cDNA ORF Clone, Mouse, C-His tag MG50868-CH
    CHRDL1 cDNA ORF Clone, Mouse, C-HA tag MG50868-CY
    CHRDL1 cDNA ORF Clone, Mouse, N-HA tag MG50868-NY
    CHRDL1 cDNA ORF Clone, Mouse, C-Myc tag MG50868-CM
    CHRDL1 cDNA ORF Clone, Mouse, N-Myc tag MG50868-NM
    CHRDL1 qPCR Primer Pairs, Mouse MP200839

    CHRDL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CHRDL1 cDNA ORF Clone in Cloning Vector, Human HG10866-M
    CHRDL1 cDNA ORF Clone, Human, untagged HG10866-UT
    CHRDL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10866-ACG
    CHRDL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10866-ACGLN
    CHRDL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10866-ACR
    CHRDL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10866-CF
    CHRDL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10866-NF
    CHRDL1 cDNA ORF Clone, Human, C-His tag HG10866-CH
    CHRDL1 cDNA ORF Clone, Human, N-His tag HG10866-NH
    CHRDL1 cDNA ORF Clone, Human, C-HA tag HG10866-CY
    CHRDL1 cDNA ORF Clone, Human, N-HA tag HG10866-NY
    CHRDL1 cDNA ORF Clone, Human, C-Myc tag HG10866-CM
    CHRDL1 cDNA ORF Clone, Human, N-Myc tag HG10866-NM
    CHRDL1 qPCR Primer Pairs, Human HP100756
    info info
    添加购物车成功! 添加购物车失败!