CHORDC1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52677-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHORDC1 Reagents
CRO Services
Product recommended

All CHORDC1 Reagents
CHORDC1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Mouse cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHORDC1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1110001O09Rik cDNA ORF Clone, Mouse;AA409036 cDNA ORF Clone, Mouse;Chp-1 cDNA ORF Clone, Mouse;morgana cDNA ORF Clone, Mouse
CHORDC1 Background Information
Full Name
cysteine and histidine-rich domain (CHORD) containing 1

CHORDC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHORDC1 cDNA ORF Clone in Cloning Vector, Rat RG8A2969-U
CHORDC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A2969-ACGLN

CHORDC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHORDC1 cDNA ORF Clone in Cloning Vector, Mouse MG52677-U
CHORDC1 cDNA ORF Clone, Mouse, untagged MG52677-UT
CHORDC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52677-ACGLN
CHORDC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52677-ACG
CHORDC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52677-ANG
CHORDC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52677-ACR
CHORDC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52677-ANR
CHORDC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52677-CF
CHORDC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52677-NF
CHORDC1 cDNA ORF Clone, Mouse, C-His tag MG52677-CH
CHORDC1 cDNA ORF Clone, Mouse, N-His tag MG52677-NH
CHORDC1 cDNA ORF Clone, Mouse, C-HA tag MG52677-CY
CHORDC1 cDNA ORF Clone, Mouse, N-HA tag MG52677-NY
CHORDC1 cDNA ORF Clone, Mouse, C-Myc tag MG52677-CM
CHORDC1 qPCR Primer Pairs, Mouse MP202548

CHORDC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHORDC1 cDNA ORF Clone in Cloning Vector, Human HG16949-U
CHORDC1 cDNA ORF Clone, Human, untagged HG16949-UT
CHORDC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16949-ACG
CHORDC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16949-ACGLN
CHORDC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16949-ANG
CHORDC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16949-ACR
CHORDC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16949-ANR
CHORDC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16949-CF
CHORDC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16949-NF
CHORDC1 cDNA ORF Clone, Human, C-His tag HG16949-CH
CHORDC1 cDNA ORF Clone, Human, N-His tag HG16949-NH
CHORDC1 cDNA ORF Clone, Human, C-HA tag HG16949-CY
CHORDC1 cDNA ORF Clone, Human, N-HA tag HG16949-NY
CHORDC1 cDNA ORF Clone, Human, C-Myc tag HG16949-CM
CHORDC1 cDNA ORF Clone, Human, N-Myc tag HG16949-NM
info info
添加购物车成功! 添加购物车失败!