CHMP2B cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51473-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHMP2B Reagents
CRO Services
Product recommended

All CHMP2B Reagents
CHMP2B cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Mouse charged multivesicular body protein 2B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHMP2B cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1190006E07Rik cDNA ORF Clone, Mouse
CHMP2B Background Information
Full Name
charged multivesicular body protein 2B

CHMP2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHMP2B cDNA ORF Clone in Cloning Vector, Mouse MG51473-U
CHMP2B cDNA ORF Clone, Mouse, untagged MG51473-UT
CHMP2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51473-ACG
CHMP2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51473-ACGLN
CHMP2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51473-ANG
CHMP2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51473-ACR
CHMP2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51473-ANR
CHMP2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51473-CF
CHMP2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51473-NF
CHMP2B cDNA ORF Clone, Mouse, C-His tag MG51473-CH
CHMP2B cDNA ORF Clone, Mouse, N-His tag MG51473-NH
CHMP2B cDNA ORF Clone, Mouse, C-HA tag MG51473-CY
CHMP2B cDNA ORF Clone, Mouse, N-HA tag MG51473-NY
CHMP2B cDNA ORF Clone, Mouse, C-Myc tag MG51473-CM
CHMP2B qPCR Primer Pairs, Mouse MP201357

CHMP2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHMP2B cDNA ORF Clone in Cloning Vector, Human HG14596-G
CHMP2B cDNA ORF Clone, Human, untagged HG14596-UT
CHMP2B cDNA ORF Clone, Human, C-GFPSpark® tag HG14596-ACG
CHMP2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14596-ACGLN
CHMP2B cDNA ORF Clone, Human, N-GFPSpark® tag HG14596-ANG
CHMP2B cDNA ORF Clone, Human, C-OFPSpark® tag HG14596-ACR
CHMP2B cDNA ORF Clone, Human, N-OFPSpark® tag HG14596-ANR
CHMP2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14596-CF
CHMP2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14596-NF
CHMP2B cDNA ORF Clone, Human, C-His tag HG14596-CH
CHMP2B cDNA ORF Clone, Human, N-His tag HG14596-NH
CHMP2B cDNA ORF Clone, Human, C-HA tag HG14596-CY
CHMP2B cDNA ORF Clone, Human, N-HA tag HG14596-NY
CHMP2B cDNA ORF Clone, Human, C-Myc tag HG14596-CM
CHMP2B cDNA ORF Clone, Human, N-Myc tag HG14596-NM
CHMP2B qPCR Primer Pairs, Human HP103230
info info
添加购物车成功! 添加购物车失败!