CHEK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50432-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHEK2 Reagents
CRO Services
Product recommended

All CHEK2 Reagents
CHEK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1680 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1230C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse CHK2 checkpoint homolog (S. pombe) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + NotI(6kb+1.68kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CHEK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHEK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Cynomolgus CDCP1 Gene Plasmid Map 5627
Mouse CHK2/CHEK2 Gene Expression validated Image 16079
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CHEK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Cds1 cDNA ORF Clone, Mouse;CHK2 cDNA ORF Clone, Mouse;HUCDS1 cDNA ORF Clone, Mouse;Rad53 cDNA ORF Clone, Mouse
CHEK2 Background Information

In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by CHEK2 gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded CHEK2 protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in CHEK2s gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
checkpoint kinase 2
References
  • Bogdanova N, et al. (2005) Association of two mutations in the CHEK2 gene with breast cancer. Cancer Genetics. 116(2) : 263-6.
  • Dong XY, et al. (2003) Mutations in CHEK2 associated with prostate cancer risk. The American journal of human genetics. 72(2) 270-80.
  • Massink MPG, Kooi IE, Martens JWM, Waisfisz Q, Meijers-Heijboer H. Genomic profiling of CHEK2*1100delC-mutated breast carcinomas. BMC Cancer. 2015;15:877. doi:10.1186/s12885-015-1880-y.
  • CHEK2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CHEK2 cDNA ORF Clone in Cloning Vector, Mouse MG50432-M
    CHEK2 cDNA ORF Clone, Mouse, untagged MG50432-UT
    CHEK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50432-ACG
    CHEK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50432-ACGLN
    CHEK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50432-ANG
    CHEK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50432-ACR
    CHEK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50432-ANR
    CHEK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50432-NF
    CHEK2 cDNA ORF Clone, Mouse, C-His tag MG50432-CH
    CHEK2 cDNA ORF Clone, Mouse, N-His tag MG50432-NH
    CHEK2 cDNA ORF Clone, Mouse, C-HA tag MG50432-CY
    CHEK2 cDNA ORF Clone, Mouse, N-HA tag MG50432-NY
    CHEK2 cDNA ORF Clone, Mouse, C-Myc tag MG50432-CM
    CHEK2 cDNA ORF Clone, Mouse, N-Myc tag MG50432-NM
    CHEK2 qPCR Primer Pairs, Mouse MP200441

    CHEK2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CHEK2 cDNA ORF Clone in Cloning Vector, Human HG11414-M
    CHEK2 cDNA ORF Clone, Human, untagged HG11414-UT
    CHEK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11414-ACG
    CHEK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11414-ACGLN
    CHEK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11414-ANG
    CHEK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11414-ACR
    CHEK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11414-ANR
    CHEK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11414-CF
    CHEK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11414-NF
    CHEK2 cDNA ORF Clone, Human, C-His tag HG11414-CH
    CHEK2 cDNA ORF Clone, Human, N-His tag HG11414-NH
    CHEK2 cDNA ORF Clone, Human, C-HA tag HG11414-CY
    CHEK2 cDNA ORF Clone, Human, N-HA tag HG11414-NY
    CHEK2 cDNA ORF Clone, Human, C-Myc tag HG11414-CM
    CHEK2 cDNA ORF Clone, Human, N-Myc tag HG11414-NM
    CHEK2 qPCR Primer Pairs, Human HP101292
    info info
    添加购物车成功! 添加购物车失败!