Quick Order

Mouse CD32/Fc gamma RII/FCGR2 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse FCGR2 cDNA Clone Product Information
NCBI RefSeq:NM_001077189.1
RefSeq ORF Size:1023bp
cDNA Description:Full length Clone DNA of Mus musculus Fc receptor, IgG, low affinity IIb with C terminal HA tag.
Gene Synonym:CD32, Fcgr2, Fcr-2, Fcr-3, Ly-17, LyM-1, Lym-1, FcgRII, Fcgr2a, Ly-m20, AI528646, Fc[g]RII, F630109E10Rik
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Receptors for Fc portion of IgG (Fcγ Rs) are members of the Ig superfamily, and are divided into three classes designated Fcγ RI (CD64), Fcγ RII (CD32), and Fcγ RIII (CD16). CD32 protein is a low affinity receptor for IgG that binds only IgG immune complexes and is expressed on a diverse range of cells such as monocytes, macrophages, neutrophils, eosinophils, platelets, and B cells. Human CD32 class is encoded by three closely related genes, and designated Fcγ RII A, B, and C which share 94-99% amino acid identity in their extracellular domains but differ substantially in their transmembrane and cytoplasmic domains. CD32 is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators, and regulation of antibody production.

References
  • Williams TE, et al. (2000) Concurrent and independent binding of Fcgamma receptors IIa and IIIb to surface-bound IgG. Biophys J. 79(4): 1867-75.
  • Kanters D, et al. (2007) Expression of activated Fc gamma RII discriminates between multiple granulocyte-priming phenotypes in peripheral blood of allergic asthmatic subjects. J Allergy Clin Immunol. 120(5): 1073-81.
  • Veri MC, et al. (2007) Monoclonal antibodies capable of discriminating the human inhibitory Fcgamma-receptor IIB (CD32B) from the activating Fcgamma-receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 121(3): 392-404.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"