CES2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50515-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CES2 Reagents
CRO Services
Product recommended

All CES2 Reagents
CES2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1686 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse carboxylesterase 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.73kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CES2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CES2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse CES2/Carboxylesterase 2 Gene Expression validated Image 2201
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
CES2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
ces2A3 cDNA ORF Clone, Mouse
CES2 Background Information

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

Full Name
carboxylesterase 2
References
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • CES2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CES2 cDNA ORF Clone in Cloning Vector, Mouse MG50515-M
    CES2 cDNA ORF Clone, Mouse, untagged MG50515-UT
    CES2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50515-ACG
    CES2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50515-ACGLN
    CES2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50515-ACR
    CES2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50515-NF
    CES2 cDNA ORF Clone, Mouse, C-His tag MG50515-CH
    CES2 cDNA ORF Clone, Mouse, N-His tag MG50515-NH
    CES2 cDNA ORF Clone, Mouse, C-HA tag MG50515-CY
    CES2 cDNA ORF Clone, Mouse, N-HA tag MG50515-NY
    CES2 cDNA ORF Clone, Mouse, C-Myc tag MG50515-CM
    CES2 cDNA ORF Clone, Mouse, N-Myc tag MG50515-NM
    CES2 qPCR Primer Pairs, Mouse MP200507

    CES2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CES2 cDNA ORF Clone in Cloning Vector, Human HG10380-M
    CES2 cDNA ORF Clone, Human, untagged HG10380-UT
    CES2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10380-ACG
    CES2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10380-ACGLN
    CES2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10380-ANG
    CES2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10380-ACR
    CES2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10380-ANR
    CES2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10380-CF
    CES2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10380-NF
    CES2 cDNA ORF Clone, Human, C-His tag HG10380-CH
    CES2 cDNA ORF Clone, Human, N-His tag HG10380-NH
    CES2 cDNA ORF Clone, Human, C-HA tag HG10380-CY
    CES2 cDNA ORF Clone, Human, N-HA tag HG10380-NY
    CES2 cDNA ORF Clone, Human, C-Myc tag HG10380-CM
    CES2 cDNA ORF Clone, Human, N-Myc tag HG10380-NM
    CES2 qPCR Primer Pairs, Human HP105189
    info info
    添加购物车成功! 添加购物车失败!